Skip to main content
Have a personal or library account? Click to login
Resensitization of Fluconazole-Resistant Urinary Candida spp. Isolates by Amikacin through Downregulation of Efflux Pump Genes Cover

Resensitization of Fluconazole-Resistant Urinary Candida spp. Isolates by Amikacin through Downregulation of Efflux Pump Genes

Open Access
|Mar 2020

Figures & Tables

Table I

Sequences of primers for the genes selected for transcript analysis using quantitative RT-PCR.

GeneOrientationSequence (5′–3′)Reference
ACT1 FTTGGTGATGAAGCCCAATCC Chau et al. 2004
RCATATCGTCCCAGTTGGAAACA
MDR1 FTTACCTGAAACTTTTGGCAAAACA Chau et al. 2004
RACTTGTGATTCTGTCGTTACCG
CDR1 FTTTAGCCAGAACTTTCACTCATGATT Chau et al. 2004
RTATTTATTTCTTCATGTTCATATGGATTGA
CDR2 FGGTATTGGCTGGTCCTAATGTGA Chau et al. 2004
RGCTTGAATCAAATAAGTGAATGGATTAC
Table II

Demographic profile of candiduric patients.

Demographic variables
SexAge group (years)
MaleFemale30–4041–5051–6061– > 70
n%n%n%n%n%n%
Candida albicans (n = 18)1161.1738.900633.315.61161.1
Non-albicans Candida isolates (n = 10)550550110330110550
Total (n = 28)1657.11242.913.6932.127.11657.1
Table III

Identification, virulence determinants, and the minimum inhibitory concentration (MIC) of fluconazole against the Candida spp. isolates tested.

Isolate codeCandida speciesVirulence determinantsMIC of Fluconazole (μg/ml) c
Biofilm formationProteases production Pz value a Phospholipase production Pz value b
C1 C. tropicalis Strong0.260.33128
C2 C. albicans Strong0.40.4816
C3 C. albicans Strong0.160.298
C4 C. albicans Strong0.190.2932
C5 C. albicans Strong0.218
C6 C. albicans Strong0.20.31024
C7 C. tropicalis Strong0.220.23128
C8 C. glabrata Weak0.180.211024
C9 C. glabrata Weak0.670.221024
C10 C. glabrata Moderate0.50.232
C11 C. albicans Strong0.260.2616
C12 C. glabrata Moderate0.430.2332
C13 C. albicans Strong0.40.28
C14 C. albicans Strong0.260.3256
C15 C. albicans Strong0.240.2416
C16 C. albicans Strong0.240.248
C17 C. albicans Strong0.150.271024
C18 C. glabrata Moderate0.250.218
C19 C. albicans Weak0.150.672
C20 C. albicans Strong0.140.311024
C21 C. albicans Strong0.170.41024
C22 C. albicans Weak0.150.391
C23 C. albicans Strong0.180.321024
C24 C. albicans Strong0.170.418
C25 C. glabrata Weak0.170.238
C26 C. glabrata Moderate0.20.16256
C27 C. albicans Strong0.160.3216
C28 C. famata Strong0.160.4128

1a The Pz (precipitation zone) value: 1 (negative), 0.75–0.9 (low producers), 0.51–0.74 (moderate producers) and 0.35–0.5 (high producers)

2b The Pz value: 1 (negative), < 1 – > 0.63 (moderate), and < 0.63 (strong)

3c CLSI breakpoint for fluconazole is 64 μg/ml

Table IV

Fluconazole susceptibility of different Candida spp.

Candida speciesFluconazole susceptibility n (%)MIC50 MIC90 MIC range (μg/ml)
SR
Candida albicans (n = 18)12 (66.7%)6 (33.3%)1610241–1024
Non-albicans Candida isolates (n = 10)4 (40%)6 (60%)12810248–1024
Candida glabrata (n = 7)4 (57.1%) a 3 (42.9%)3210248–1024
Candida tropicalis (n = 2)0 (0%) a 2 (100%)128 b ND c ND
Candida famata (n = 1)0 (0%) a 1 (100%)NDNDND

4a The percentage was calculated relative to the total number of non-albicans Candida isolates collected in this study

5b MIC50 is calculated here as the arithmetic mean of the MIC values for both Candida tropicalis strains

6c ND – not determined

Table V

Resistance-modulating effect of amikacin (4000 μg/ml) on fluconazole-resistant Candida clinical isolates.

Isolate codeCandida speciesMIC of fluconazole alone (μg/ml)MIC of fluconazole (μg/ml) in the presence of amikacinModulation factor (MF) a
C1 C. tropicalis 128432
C6 C. albicans 10244256
C7 C. tropicalis 128432
C8 C. glabrata 10243232
C9 C. glabrata 10243232
C14 C. albicans 256464
C17 C. albicans 10244256
C20 C. albicans 10244256
C21 C. albicans 10244256
C23 C. albicans 10244256
C26 C. glabrata 2562561
C28 C. famata 128432

7a Modulation factor (MF) was calculated as MICfluconazole alone/MICfluconazole + amikacin

Fig. 1.

Inhibitory effect of amikacin (4,000 μg/ml) on the efflux of rhodamine in fluconazole-resistant Candida albicans (C6).

Fig. 2.

Inhibitory effect of amikacin (4,000 μg/ml) on the efflux of rhodamine in fluconazole-resistant Candida glabrata (C8).

Fig. 3.

Inhibitory effect of amikacin (4,000 μg/ml) on the efflux of rhodamine in fluconazole-resistant Candida albicans (C21).

Fig. 4.

Percentage of reduction in the rhodamine fluorescence intensity after 120 minutes of amikacin (4,000 μg/ml) treatment of C6, C21 and C8 Candida isolates.

Fig. 5.

Relative gene expression levels of the efflux pump mediated genes MDR1, CDR1, and CDR2 in (A) Candida albicans C6 and (B) Candida albicans C21 as measured by the quantitative real-time PCR. Total RNAs were prepared from both selected isolates after 48-hour treatment with 4,000 μg/ml amikacin. The levels of transcripts were normalized to the level of the ACT1 gene expression and then compared to the level of expression in the untreated control cells. The level of gene transcript in control untreated cells (CO) was set as 1. Results were expressed as the means and standard deviations of three independent determinations. The error bars represent SDs.

DOI: https://doi.org/10.33073/pjm-2020-010 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Language: English
Page range: 73 - 84
Submitted on: Nov 12, 2019
Accepted on: Feb 6, 2020
Published on: Mar 11, 2020
Published by: Polish Society of Microbiologists
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2020 EVA A. EDWARD, NELLY M. MOHAMED, AZZA S. ZAKARIA, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.