Pre-probiotic effects of different bacterial species in aquaculture: behavioral, hematological and oxidative stress responses Cover

.blurhash-client-img { display: none !important; }

Pre-probiotic effects of different bacterial species in aquaculture: behavioral, hematological and oxidative stress responses

Oceanological and Hydrobiological Studies

Volume 51 (2022): Issue 2 (June 2022)

By: Gonca Alak, Recep Kotan, Arzu Uçar, Veysel Parlak and Muhammed Atamanalp

Open Access

|Jul 2022

Figures & Tables

Results of critical swimming performance

Results of AChE enzyme activity in brain

Sequences of primers

Primer	Primer Sequence (5’-3’)
27 Forward	AGAGTTTGATCCTGGCTCAG
1492 Reverse	GGTTACCTTGTTACGACTT

Parameters of the trial water

Water quality parameters	Beginning of the treatment (Hour 0)					End of the treatment (Hour 96)
Water quality parameters	A	B	C	D	E	A	B	C	D	E
Temperature	8.3	8.6	8	10	8.6	10.06	10.5	8.5	9.6	8.1
Oxygen	8.44	9.18	9.57	7.5	9.18	5.87	4.66	9.23	6.55	9.09
EC	0.220	0.222	0.215	0.217	0.222	0.237	0.237	0.220	0.241	0.205
pH	8.29	8.25	8.34	8.30	8.25	7.84	7.96	8.28	8.02	8.09

Hematological indices in the groups

Treatment	WBC (10⁴ mm³)	RBC (10⁶ mm³)	PLT (10⁴ mm³)	ESR (mm h^-1)	Hb (g dl^-1)	Hct (%)	MCV (μm³)	MCH (pg)	MCHC (g 100ml^-1)
A	10.65 ± 2.03^c	3.07 ± 0.05^a	14.33 ± 2.16^b	0.18 ± 0.04^a	8.59 ± 0.8^a^b	33.50 ± 5.57^b	117.07 ± 13.10^b	29.21 ± 3.91 ^a	27.30 ± 3.06 ^a
B	17.98 ± 2.03^a	3.42 ± 0.05^a	23.92 ± 2.16 ^a	0.13 ± 0.04^a	9.47 ± 0.8 ^a	47.58 ± 5.57 ^a	142.78 ± 13.10^a^b	28.64 ± 3.91 ^a	20.58 ± 3.06^b
C	14.73 ± 2.03^b	3.33 ± 0.05^a	22.07 ± 2.16 ^a	0.16 ± 0.04 ^a	7.41 ± 0.8^b	44.25 ± 5.57 ^a	136.06 ± 13.10^a^b	22.82 ± 3.91 ^a	17.11 ± 3.06^b
D	12.91 ± 2.03^bc	3.15 ± 0.05^a	16.00 ± 2.16^b	0.26 ± 0.04 ^a	8.07 ± 0.8^a^b	52.56 ± 5.57 ^a	168.99 ± 13.10 ^a	26.44 ± 3.91 ^a	16.19 ± 3.06^b
E	15.00 ± 2.03^b	3.40 ± 0.05^a	22.92 ± 2.16^a	0.23 ± 0.04 ^a	8.10 ± 0.8^a^b	47.50 ± 5.57 ^a	141.13 ± 13.10^a^b	24.33 ± 3.91 ^a	17.15 ± 3.06^b

Oxidative stress response of gill and liver tissues in the groups

Tissues	Treatment	Oxidative stress response
Tissues	Treatment	CAT (EU mg^-1)	SOD (EU mg^-1)	GR (EU mg^-1)	GST (EU mg^-1)	G6PD (EU mg^-1)	GPx (EU mg^-1)	MDA (nmol protein^-1)
	A	0.98 ± 0.03^b	0.24 ± 0.03^b^b	0.39 ± 0.08 ^b^b	0.22 ± 0.04 ^a	0.26 ± 0.03 ^a	0.49 ± 0.02 ^b	3.30 ± 0.03 ^b^b
	B	0.43 ± 0.03^b	0.20 ± 0.03 ^b^b	0.38 ± 0.08 ^b^b	0.19 ± 0.04 ^a	0.05 ± 0.03 ^b	0.26 ± 0.02 ^b	3.79 ± 0.03 ^a
Gill	C	2.44 ± 0.03^a	0.29 ± 0.03^a	0.65 ± 0.08^a	0.30 ± 0.04 ^a	0.26 ± 0.03 ^a	1.45 ± 0.02 ^a	2.33 ± 0.03 ^b
	D	2.40 ± 0.03^a	0.28 ± 0.03 ^a	0.39 ± 0.08 ^b^b	0.28 ± 0.04 ^a	0.38 ± 0.03 ^a	0.61 ± 0.02 ^b^b	2.52 ± 0.03 ^b^b
	E	0.55 ± 0.03 ^b	0.15 ± 0.03 ^b	0.34 ± 0.08^b	0.22 ± 0.04 ^a	0.05 ± 0.03 ^b	0.69 ± 0.02 ^b^b	2.64 ± 0.03 ^b^b
	A	1.83 ± 0.02^b^b	0.27 ± 0.04^bc	0.51 ± 0.02 ^a	0.22 ± 0.02 ^b^b	0.17 ± 0.02 ^b	1.19 ± 0.01 ^b^b	0.57 ± 0.03 ^b^b
	B	0.39 ± 0.02 ^b	0.18 ± 0.04^cd	0.27 ± 0.02 ^a	0.16 ± 0.02 ^b^b	0.14 ± 0.02 ^b	0.25 ± 0.01 ^b	0.76 ± 0.03 ^b^b
Liver	C	4.49 ± 0.02^a	0.43 ± 0.04 ^a	0.54 ± 0.02 ^a	0.33 ± 0.02 ^a	0.78 ± 0.02 ^a	2.03 ± 0.01 ^a	0.05 ± 0.03 ^b
	D	3.13 ± 0.02^b^b	0.34 ± 0.04 ^b^b	0.45 ± 0.02 ^a	0.24 ± 0.02^b^b	0.40 ± 0.02 ^b	0.88 ± 0.01 ^b	0.24 ± 0.03 ^b
	E	0.25 ± 0.02 ^b	0.13 ± 0.04^d	0.18 ± 0.02 ^a	0.11 ± 0.02 ^b	0.09 ± 0.02 ^b	0.26 ± 0.01 ^b	1.16 ± 0.03 ^a

PCR mix content and cycle conditions

PCR Mix	Amount	PCR Cycle
dH₂O	37.2 μl	1	95°C	2 min	1 cycle
10X PZR tampon	5 μl	2	94°C	1 min
MgCl₂	3 μl	3	53°C	1 min	35 cycle
dNTP mix	0.7 μl	4	72°C	1.30 min
Forward primer	0.8 μl	5	72°C	10 min	1 cycle
Reverse primer	0.8 μl	6	4°C	∞
DNA	2 μl
Taq Polymerase (250 U)	0.5 μl
Total	50 μl

Experimental design

Treatment code	Strains
A	FD-1
B	FDG-37
C	FD-48
D	TV-17C
E	No bacteria

Results of sequences

Treatment code	Strains	Identification results	Genbank Numbers
A	FD-1	Brevibacillus brevis	MW847612
B	FDG-37	Pseudomonas fluorescens	MW740242
C	FD-48	Bacillus sphaericus	MW751888
D	TV-17C	Bacillus amyloliquefaciens	MW751910

DOI: https://doi.org/10.26881/oandhs-2022.2.01 | Journal eISSN: 1897-3191 | Journal ISSN: 1730-413X

Journal RSS Feed

Language: English

Page range: 133 - 142

Submitted on: Apr 1, 2022

Accepted on: Apr 20, 2022

Published on: Jul 7, 2022

Published by: University of Gdańsk

In partnership with: Paradigm Publishing Services

Publication frequency: 4 issues per year

Keywords:

ecosystem management,

oxidative stress,

Related subjects:

Chemistry, other,

Geosciences, other,

Life sciences, other

© 2022 Gonca Alak, Recep Kotan, Arzu Uçar, Veysel Parlak, Muhammed Atamanalp, published by University of Gdańsk
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Volume 51 (2022): Issue 2 (June 2022)Next article