Primers used in the study and RFLP fragment sizes for VDR SNP genotyping_
| VDR gene Restriction site | Primers | RFLP fragments (bp) | Restriction enzyme |
|---|---|---|---|
| 31236 | F:CAGAGCATGGACAGGGAGCAAG | 494, 293, 251, 201 | Taq I |
| 1544410 | F:CAACCAAGACTACAAGTACCGCGTCAGTGA | 800, 650, 150 | Bsm I |
| 7975232 | F:CAGAGCATGGACAGGGAGCAA | 740, 520, 220 | Apa I |
| 10735810 | F:AGCTGGCCCTGGCACTGACTCTGCTCT | 96, 169, 265 | Fok I |
Taq I VDR gene polymorphism in cases and control subjects_
| Model | Genotype | Control N=100 | Cases N=100 | OR (95% CI) | p-value |
|---|---|---|---|---|---|
| T/T | 27 (54%) | 46 (46%) | 1.00 | ||
| Co-dominant | T/t | 18 (36%) | 38 (38%) | 1.24 (0.59–2.58) | 0.64 |
| t/t | 5 (10%) | 14 (14) | 1.64 (0.53–5.07) | ||
| Dominant | T/T | 27 (54%) | 46 (46%) | 1.00 | |
| T/t-t/t | 23 (46%) | 53 (53%) | 1.33 (0.67–2.63) | 0.42 | |
| Recessive | T/T-T/t | 45 (90%) | 85 (85%) | 1.00 | |
| t/t | 5 (10%) | 14 (14%) | 1.50 (0.51–4.43) | 0.45 | |
| Over-dominant | T/T-t/t | 32 (64%) | 61 (61%) | 1.00 | |
| T/t | 18 (36%) | 38 (38%) | 1.13 (0.56–2.28) | 0.74 | |
| Allele | T | 72 (72%) | 132 (66%) | ||
| t | 28 (28%) | 68 (34%) | 1.30 (0.77–2.21) | 0.35 |
Apa-I VDR gene polymorphism in cases and control subjects_
| Model | Genotype | Control N=100 | Cases N=100 | OR (95% CI) | p-value |
|---|---|---|---|---|---|
| A/A | 58 (58%) | 46 (46%) | 1.00 | ||
| Co-dominant | A/a | 26 (26%) | 31 (31%) | 1.50 (0.68–3.34) | |
| a/a | 16 (16%) | 21 (21%) | 1.65 (0.65–4.23) | 0.44 | |
| Dominant | A/A | 58 (58%) | 46 (46%) | 1.00 | |
| A/a-a/a | 42 (42%) | 53 (53%) | 1.56 (0.78–3.10) | 0.2 | |
| Recessive | A/A-A/a | 84 (84%) | 78 (78%) | 1.00 | |
| a/a | 16 (16%) | 21 (21%) | 1.43 (0.58–3.51) | 0.43 | |
| Over-dominant | A/A-a/a | 74 (74%) | 68 (68%) | 1.00 | |
| A/a | 26 (26%) | 31 (31%) | 1.32 (0.61–2.82) | 0.48 | |
| Allele | A | 142 (71%) | 126 (63%) | ||
| a | 58 (29%) | 74 (37%) | 1.45 (0.86–2.44) | 0.19 |
Demographics, clinical, and biochemical variables in cases and control subjects_
| Demographics | Controls (Mean±SD) | Cases (Mean±SD) | p-value |
|---|---|---|---|
| Age | 49.5±16.5 | 51.65±17.5 | >0.05 |
| SBP | 115.5±7.5 | 116.5±8.5 | 0.0001 |
| DBP | 77.8±9.5 | 89.5±10.9 | 0.0001 |
| 25-hydroxy vitamin D (ng/ml) | 51.52±11.5 | 20.2±8.5 | 0.0001 |
| Fasting blood sugar (mg/dl) | 113.2±10.5 | 119.8±11.5 | >0.05 |
| Total cholesterol (mg/dl) | 185.5±20.8 | 255.5±50.5 | 0.0001 |
| Triglycerides (mg/dl) | 99.7±19.5 | 240.31±52.5 | 0.0001 |
| HDL-C (mg/dl) | 49.6±8.5 | 42.18±10.5 | 0.0001 |
| LDL-C (mg/dl) | 58.5±12.5 | 131.5±45.8 | 0.0001 |
| VLDL-C (mg/dl) | 21.3±10.6 | 49.9±11.2 | 0.0001 |
| hsCRP (mg/L) | 0.61±1.5 | 6.22±2.5 | >0.05 |
| Serum creatinine (mg/dl) | 0.85±0.075 | 0.92±0.08 | >0.05 |
Fok I VDR gene polymorphism in cases and control subjects_
| Model | Genotype | Control N=100 | Cases N=100 | OR (95% CI) | p-value |
|---|---|---|---|---|---|
| F/F | 70 (70%) | 68 (68%) | 1.00 | ||
| Co-dominant | F/f | 14 (14%) | 29 (29%) | 2.16 (0.86–5.44) | |
| f/f | 16 (16%) | 2 (2%) | 0.13 (0.03–0.65) | 0.0018 | |
| Dominant | F/F | 70 (70%) | 68 (68%) | 1.00 | |
| F/f-f/f | 15 (30%) | 31 (31%) | 1.08 (0.52–2.26) | 0.84 | |
| Recessive | F/F-F/f | 84 (84%) | 97 (97%) | 1.00 | |
| f/f | 16 (16%) | 2 (2%) | 0.11 (0.02–0.54) | 0.0018 | |
| Over-dominant | F/F-f/f | 86 (86%) | 70 (70%) | 1.00 | |
| F/f | 14 (14%) | 29 (29%) | 2.58 (1.04–6.41) | 0.031 | |
| Allele | F | 144 (77%) | 166 (83%) | 0.67 (0.37–1.23) | |
| f | 46 (23%) | 34 (17%) | 0.21 |
Bsm I VDR gene polymorphism in cases and control subjects_
| Model | Genotype | Control N=100 | Cases N=102 | OR (95% CI) | p-value |
|---|---|---|---|---|---|
| B/B | 62 (62%) | 61 (61%) | 1.00 | ||
| Co-dominant | B/b | 12 (12%) | 26 (26%) | 2.24 (0.83–6.01) | |
| b/b | 26 (26%) | 12 (12%) | 0.48 (0.19–1.17) | 0.029 | |
| Dominant | B/B | 62 (62%) | 61 (61%) | 1.00 | |
| B/b-b/b | 38 (38%) | 38 (38%) | 1.03 (0.51–2.08) | 0.93 | |
| Recessive | B/B-B/b | 37 (74%) | 86 (86%) | 1.00 | |
| b/b | 26 (26%) | 12 (12%) | 0.40 (0.17–0.95) | 0.039 | |
| Over-dominant | B/B-b/b | 88 (88%) | 73 (73%) | 1.00 | |
| B/b | 12 (12%) | 26 (26%) | 2.65 (1.01–6.94) | 0.035 | |
| Allele | B | 136 (68%) | 148 (74%) | ||
| b | 64 (32%) | 52 (26%) | 0.72 (0.42–1.23) | 0.27 |