Skip to main content
Have a personal or library account? Click to login
A Correlative Study of Vitamin D Receptor Variants Fok1, Apa1, Bsm1, and Taq1 Polymorphism and Vitamin D Deficiency with Higher Risk Ratio of Coronary Artery Disease in Female Population Cover

A Correlative Study of Vitamin D Receptor Variants Fok1, Apa1, Bsm1, and Taq1 Polymorphism and Vitamin D Deficiency with Higher Risk Ratio of Coronary Artery Disease in Female Population

Open Access
|Jun 2023

Figures & Tables

Table 1

Primers used in the study and RFLP fragment sizes for VDR SNP genotyping.

VDR gene Restriction sitePrimersRFLP fragments (bp)Restriction enzyme
31236F:CAGAGCATGGACAGGGAGCAAG
R:GCAACTCCTCATGGCTGAGGTCTCA
494, 293, 251, 201Taq I
1544410F:CAACCAAGACTACAAGTACCGCGTCAGTGA
R:AACCAGCGGGAAGAGGTCAAGGG
800, 650, 150Bsm I
7975232F:CAGAGCATGGACAGGGAGCAA
R:TCATGGCTGAGGTCTCAAGGG
740, 520, 220Apa I
10735810F:AGCTGGCCCTGGCACTGACTCTGCTCT
R:ATGGAAACACCTTGCTTCTTCTCCCTC
96, 169, 265Fok I
Table 2

Demographics, clinical, and biochemical variables in cases and control subjects.

DemographicsControls (Mean±SD)Cases (Mean±SD)p-value
Age49.5±16.551.65±17.5>0.05
SBP115.5±7.5116.5±8.50.0001
DBP77.8±9.589.5±10.90.0001
25-hydroxy vitamin D (ng/ml)51.52±11.520.2±8.50.0001
Fasting blood sugar (mg/dl)113.2±10.5119.8±11.5>0.05
Total cholesterol (mg/dl)185.5±20.8255.5±50.50.0001
Triglycerides (mg/dl)99.7±19.5240.31±52.50.0001
HDL-C (mg/dl)49.6±8.542.18±10.50.0001
LDL-C (mg/dl)58.5±12.5131.5±45.80.0001
VLDL-C (mg/dl)21.3±10.649.9±11.20.0001
hsCRP (mg/L)0.61±1.56.22±2.5>0.05
Serum creatinine (mg/dl)0.85±0.0750.92±0.08>0.05

1 SBP: systolic blood pressure; DBP: diastolic blood pressure; FBS: fasting blood sugar; HDL-C: high-density lipoprotein cholesterol; LDL-C: low-density lipoprotein cholesterol; VLDL-C: very low-density lipoprotein cholesterol; CRP: c-reactive protein.

Table 3

Fok I VDR gene polymorphism in cases and control subjects.

ModelGenotypeControl N=100Cases N=100OR (95% CI)p-value
 F/F70 (70%)68 (68%)1.00 
Co-dominantF/f14 (14%)29 (29%)2.16 (0.86–5.44) 
 f/f16 (16%)2 (2%)0.13 (0.03–0.65)0.0018
DominantF/F70 (70%)68 (68%)1.00 
 F/f-f/f15 (30%)31 (31%)1.08 (0.52–2.26)0.84
RecessiveF/F-F/f84 (84%)97 (97%)1.00 
f/f16 (16%)2 (2%)0.11 (0.02–0.54)0.0018
Over-dominantF/F-f/f86 (86%)70 (70%)1.00 
F/f14 (14%)29 (29%)2.58 (1.04–6.41)0.031
AlleleF144 (77%)166 (83%)0.67 (0.37–1.23) 
f46 (23%)34 (17%)0.21
Table 4

Bsm I VDR gene polymorphism in cases and control subjects.

ModelGenotypeControl N=100Cases N=102OR (95% CI)p-value
 B/B62 (62%)61 (61%)1.00 
Co-dominantB/b12 (12%)26 (26%)2.24 (0.83–6.01) 
 b/b26 (26%)12 (12%)0.48 (0.19–1.17)0.029
DominantB/B62 (62%)61 (61%)1.00 
B/b-b/b38 (38%)38 (38%)1.03 (0.51–2.08)0.93
RecessiveB/B-B/b37 (74%)86 (86%)1.00 
b/b26 (26%)12 (12%)0.40 (0.17–0.95)0.039
Over-dominantB/B-b/b88 (88%)73 (73%)1.00 
B/b12 (12%)26 (26%)2.65 (1.01–6.94)0.035
AlleleB136 (68%)148 (74%)  
b64 (32%)52 (26%)0.72 (0.42–1.23)0.27
Table 5

Apa-I VDR gene polymorphism in cases and control subjects.

ModelGenotypeControl N=100Cases N=100OR (95% CI)p-value
 A/A58 (58%)46 (46%)1.00 
Co-dominantA/a26 (26%)31 (31%)1.50 (0.68–3.34) 
 a/a16 (16%)21 (21%)1.65 (0.65–4.23)0.44
DominantA/A58 (58%)46 (46%)1.00 
A/a-a/a42 (42%)53 (53%)1.56 (0.78–3.10)0.2
RecessiveA/A-A/a84 (84%)78 (78%)1.00 
a/a16 (16%)21 (21%)1.43 (0.58–3.51)0.43
Over-dominantA/A-a/a74 (74%)68 (68%)1.00 
A/a26 (26%)31 (31%)1.32 (0.61–2.82)0.48
AlleleA142 (71%)126 (63%)  
a58 (29%)74 (37%)1.45 (0.86–2.44)0.19
Table 6

Taq I VDR gene polymorphism in cases and control subjects.

ModelGenotypeControl N=100Cases N=100OR (95% CI)p-value
 T/T27 (54%)46 (46%)1.00 
Co-dominantT/t18 (36%)38 (38%)1.24 (0.59–2.58)0.64
 t/t5 (10%)14 (14)1.64 (0.53–5.07) 
DominantT/T27 (54%)46 (46%)1.00 
T/t-t/t23 (46%)53 (53%)1.33 (0.67–2.63)0.42
RecessiveT/T-T/t45 (90%)85 (85%)1.00 
t/t5 (10%)14 (14%)1.50 (0.51–4.43)0.45
Over-dominantT/T-t/t32 (64%)61 (61%)1.00 
T/t18 (36%)38 (38%)1.13 (0.56–2.28)0.74
AlleleT72 (72%)132 (66%)  
t28 (28%)68 (34%)1.30 (0.77–2.21)0.35
DOI: https://doi.org/10.2478/rjc-2023-0009 | Journal eISSN: 2734-6382 | Journal ISSN: 1220-658X
Language: English, Romanian
Page range: 60 - 66
Published on: Jun 30, 2023
Published by: Romanian Society of Cardiology
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2023 Mahaboob Vali Shaik, S Madhuri, Karnati Rohith, Swarna Deepak Kuragayala, Munni Shaik, C Bhakthavatsala Reddy, S BabuLal, Subrahmanyam Gangapatnam, published by Romanian Society of Cardiology
This work is licensed under the Creative Commons Attribution 4.0 License.