Skip to main content
Have a personal or library account? Click to login
The role of focal adhesion kinase in bladder cancer: translation from in vitro to ex vivo human urothelial carcinomas Cover

The role of focal adhesion kinase in bladder cancer: translation from in vitro to ex vivo human urothelial carcinomas

Open Access
|Sep 2025

Figures & Tables

FIGURE 1.

Schematic representation of focal adhesion kinase (FAK) inhibition. We used in vitro models of a) the primary model of differentiated normal urothelium (diff NPU), in which normal porcine urothelial (NPU) cells were maintained in culture for 4 weeks, 3 weeks of which were in medium UroM (+Ca2+ -SFBS), b) the bladder cancer urothelium early after resection of the bladder tumour, i.e. 2-day RT4 and 2-day T24 cells (RT4 (2 d) and T24 (2 d)), and of c) the bladder cancer urothelium late after resection of the bladder tumour, i.e. 7-day RT4 and 7-day T24 cells (RT4 (7 d) and T24 (7 d)). Cells were treated with FAK inhibitors PND-1186 (1 μM and 10 μM), PF-573228 (10 μM and 100 μM) and defactinib (10 μM and 100 μM) for 2 h per day for 3 consecutive days (3 × 2 h), after which cell viability was measured.

FIGURE 2.

Western blot and immunohistochemistry analysis of ex vivo human bladder cancer samples. (A) Western blot analysis showing the relative expression levels of FAK, p-FAK, E-cadherin, and N-cadherin in pT1 low-grade (LG) and highgrade (HG) cancer tissues, pT2 HG cancer tissues, and the corresponding normal tissues (labelled as “normal tissue (pT1 LG)” for example), collected from the tumour-adjacent regions, which were not deemed normal at biopsy, but only after pathological evaluation. (B) Relative protein expression levels from biopsies of 2–4 patients ± the standard error of the mean (SEM) normalised to β-actin and presented as median with interquartile range. (C) Immunohistochemistry of FAK and p-FAK in normal tissue, pT1 LG and HG cancer tissues and pT2 HG cancer tissues. FAK = focal adhesion kinase; L = lumen; LP = lamina propria; U = urothelium. Scale bar: 50 μm.

FIGURE 3.

Molecular characterisation of normal urothelial cells (NPU) and bladder cancer cells (RT4 and T24) in vitro.(A) Relative expression levels of UPK1B, UPK3A, CDH1, CDH2 and PTK2 were determined using qRT-PCR in differentiated NPU cells (diff NPU), 7-day RT4 and 7-day T24 cells (RT4 (7 d) and T24 (7 d)). (B) Expression of E-cadherin, N-cadherin, FAK and p-FAK in 2-day NPU cells (NPU (2 d)), diff NPU, 2-day RT4 cells (RT4 (2 d)), RT4 (7 d), 2-day T24 cells (T24 (2 d)) and T24 (7 d), determined by western blot. (C) The relative protein expression of E-cadherin, N-cadherin, FAK and p-FAK in NPU (2 d), diff NPU, RT4 (2 d), RT4 (7 d), T24 (2 d) and T24 (7 d) normalised to the expression of β-actin. The results are presented as median with interquartile range. (D) Quantification of FAK-positive RT4 (7 d) and T24 (7 d) by flow cytometry. Data are presented as the mean ± the standard error of the mean (SEM). *P < 0.05.

FIGURE 4.

Effect of focal adhesion kinase (FAK) silencing on the survival of 2-day RT4 and 2-day T24 cells (RT4 (2 d) and T24 (2 d)). (A–C) Gene electrotransfer (GET) of anti-FAK plasmids p44, p45 and p46 in RT4 (2 d) did not result in statistically significant FAK silencing in RT4 cells but did result in their apoptosis. (D–F) GET of anti-FAK plasmids p44, p45 and p46 caused statistically significant FAK silencing and led to apoptosis of T24 (2 d). Plasmids p44 and p45 caused a statistically significant increase in necrosis of T24 (2 d). *P < 0.05, **P < 0.001. (G) T24 cells were stably transfected with anti-FAK plasmid p45 after 14 days. However, growth of these cells was limited to a single colony, as seen under fluorescence and phase contrast microscope. Data are presented as the mean ± the standard error of the mean (SEM).

FIGURE 5.

Effect of focal adhesion kinase (FAK) inhibitors on viabilities of differentiated normal urothelial (NPU) cells (diff NPU), 2-day RT4 and 2-day T24 cells (RT4 (2 d) and T24 (2 d)). (A) Treatment with FAK inhibitor 1 μM PND-1186 for 2 h per day for 3 consecutive days (3 × 2 h) led to a significantly lower viability of T24 (2 d) than diff NPU. (B) After 3 × 2 h treatment with 100 μM PF-573228, the viability of diff NPU was significantly higher than the viabilities of RT4 (2 d) and T24 (2 d). (C) Treatment with 100 μM defactinib for 3 × 2 h resulted in the greatest decrease in the viabilities of RT4 (2 d) and T24 (2 d) compared to the viability of diff NPU. Data are presented as the mean ± the standard error of the mean (SEM). To differentiate the statistical analysis, we compare the viability between different in vitro models (*, **, ***) and the viability between the control and the treated sample within each cell type (#). #P < 0.05. *P < 0.05. **P < 0.005. ***P < 0.001.

FIGURE 6.

Effect of focal adhesion kinase (FAK) inhibitors on viabilities of differentiated normal urothelial (NPU) cells (diff NPU), 7-day RT4 and 7-day T24 cells (RT4 (7 d) and T24 (7 d)). (A) After treatment with 10 μM PND-1186 for 2 h per day for 3 consecutive days (3 × 2 h), no statistically significant differences in cell viability were observed among diff NPU, RT4 (7 d) and T24 (7 d). (B) Treatment with 100 μM PF-573228 for 3 × 2 h resulted in a significant decrease in the viabilities of both RT4 (7 d) and T24 (7 d) compared to the viability of diff NPU. (C) Treatment with 100 μM defactinib for 3 × 2 h caused the greatest difference between the viabilities of diff NPU, RT4 (7 d) and T24 (7 d). (D) Western blot of p-FAK after the 3 × 2 h treatment with 100 μM defactinib in 7-day NPU cells (NPU (7 d)), RT4 (7 d) and T24 (7 d) with GAPDH-loading control. Data are presented as the mean ± the standard error of the mean (SEM). To differentiate the statistical analysis, we compare the viability between different cell types (*, **, ***) and the viability between the control and the treated sample within each cell type (#). #P < 0.05. *P < 0.05. **P < 0.005. ***P < 0.001.

FIGURE 7.

Focal adhesion kinase (FAK) inhibition with 100 μM defactinib for 2 h per day for 2 consecutive days (2 × 2 h) leads to caspase-3-mediated apoptosis. (A) Treated 7-day RT4 cells (RT4 (7 d)) showed lower p-FAK-labelling than controls. White arrows indicate gaps in the distribution of actin filaments in treated RT4 cells. (B) 7-day T24 cells (T24 (7 d)) contained p-FAK labelling in clusters after treatment with 100 μM defactinib for 2 × 2 h (white arrowheads). No significant changes in actin filament localisation were observed in treated and control T24 cells. Scale bars: 50 μm (white), 10 μm (black). (C) Western blot analysis showed that cleaved caspase-3 was present only in RT4 (7 d) and T24 (7 d) after treatment with 100 μM defactinib for 2 h per day for 3 consecutive days (3 × 2 h).

The anti-focal adhesion kinase (FAK) plasmids and their respective sense pre-miRNA sequences_ Three plasmid DNA encoding different miRNA against FAK (anti-FAK plasmids) were constructed using the pcDNATM6_2-GW/EmGFP-miR plasmid backbone

PlasmidSense pre-miRNA sequence
p44ATCTGTTTCTGACACAGAGAC
p45AGAAATTTCTCTCTCACGCTG
p46ATAGCAGGCCACATGCTTTAC

List of Sus scrofa primers used for reverse transcription polymerase chain reaction (qRT-PCR)_ Primers in bold are identical as used for Homo sapiens qRT-PCR

Sus scrofa
ForwardReverse
GAPDHTGCACCACCAACTGCTTGGCAGGCATGGACCGAGGTCATGAG
HPRT1GGACTAATTATGGACAGGACTGACAGGTCAGCAAAGAATTTATAGC
PTK2GCTGGATTATTTCGGTGGAGCAGTAGCCGTCGATCAGGTC
UP1BAGCCTCTACCCGCTGCTTGAGGAAGAGGTTGGGTGTGAAA
UP3ATCGTTATCACGTCCATCCTGCAGACGTGTATGAAGGCTCC
CDH1GACGGCTTAAGCACGACTGCAACGCCTCCATTGCTTACTG
CDH2AGTGGGATCCCCACCGCTGAATGGAAGGCAATCCCACGTA

List of Homo sapiens primers used for reverse transcription polymerase chain reaction (qRT-PCR)_ Primers in bold are identical as used for Sus scrofa qRT-PCR

Homo sapiens
ForwardReverse
GAPDHTGCACCAACTGCTTAGCGGCATGGACTGTGGTCATGAG
HPRT1GGACTAATTATGGACAGGACTGACAGGTCAGCAAAGAATTTATAGC
PTK2GGCCCAGAAGAAGGAATGCCTTGCTTTTCGCTGT
UP1BAGCCTCTACCCACTGCTTGAGGAAGAGGTTGGGTGTGAAA
UP3ATCGTCATCACTTCCATCCTGCGGACGTGTAGGAAGACTCC
CDH1GAGGGGTTAAGCACAACAGCAATGCCATCGTTGTTCACTG
CDH2ACAGTGGCCACCTACAAAGGCCGAGATGGGGTTGATAATG
DOI: https://doi.org/10.2478/raon-2025-0052 | Journal eISSN: 1581-3207 | Journal ISSN: 1318-2099
Language: English
Page range: 349 - 367
Submitted on: May 28, 2025
Accepted on: Jun 17, 2025
Published on: Sep 5, 2025
In partnership with: Paradigm Publishing Services

© 2025 Gaja Markovic, Natasa Resnik, Aleksandar Janev, Dasa Zupancic, Gasper Grubelnik, Marusa Debeljak, Maja Cemazar, Tanja Jesenko, Masa Omerzel, Tomaz Smrkolj, Mateja Erdani Kreft, published by Association of Radiology and Oncology
This work is licensed under the Creative Commons Attribution 4.0 License.