Investigation of GSTP1 and PTEN gene polymorphisms and their association with susceptibility to colorectal cancer

Gene	Primer sequence	PCR conditions	Amplicon length (bp)	Restriction enzyme	Length of digest products (bp)	Enzyme specificity
GSTP1 (rs1695)	F:5′GGCTCTATGGGAAGGACCAGCAGG-3′ R:5′GCACCTCCATCCAGAAACTGGCG3′	30 cycles of 1 min at 94°C,1 min at 66°C and 2 min at 72°C.	445	Alw261	330+115+270	5’GTCTC(N)1↓3’ 3’CAGAG(N) 5↑5’
GSTP1 (rs1138272)	F:5′CAGCAGAGGCAGCGTGTGTGC-3′ R:5′CCCACAATGAAGGTCTTGCCTCC-3′	30 cycles of 1 min at 94°C, 1 min at 64°C and 2 min at 72°C.	565	AciI	365+120+485+80	5’C↓CG↑C’3 3’G↓GC↑G’5
PTEN (rs701848)	F:5’-GTGCTTTATTGATTTGCT-3’ R:5’AGTAGTTGTACTCCGCTT-3’	5 min at 94°C, 35 cycles of 30 s at 94°C, 30 s at 55°C, 30 s at 72°C, and 10 min extension at 72°C.	199	HaeIII	199+81+118	5’GG↑CC3’ 3’CC↑G G5’
PTEN (rs2735343)	F:5’-CTCTTCCTGTTCTCCATCGTG-3’ R:5’-TTCTCCAGGATTTCGTCTGC-3’	5 min at 94°C, 35 cycles of 30 s at 94°C, 30 s at 63°C, 30 s at 72°C and 10 min at 72°C.	272	HhaI	272+72+200	5’G↑CG↑C3’ 3’C↑GC↑G’5

1 bp = base pair; F = forward; PCR = polymerase chain reaction; R = reverse

TABLE 2.

Demographic information and risk factors in colorectal cancer (CRC) cases and control

Variable	Patients N = 200(%)	Control n = 250(%)	P value
*Age (Years)
≥ 40	132 (66.0)	151 (60.4)	0.222
< 40	68 (34.0)	99 (39.6)
Range	10-60	11-60	-
Median	46	32	-
*Gender
Male	122 (61.1)	169(68)	0.273
Female	78 (39.0)	81(32)
**Smoking status
Never	165 (82.3)	22 (8.8)	< 0.010
Ever	35 (17.6)	228 (91.1)
*Site of tumor
Colon	102(51.00)		0.984
Rectum	98(49.00)

* p > 0.05 patients vs control;

** p ≤ 0.05 patients vs controls

*GSTP1*Alleles frequency distribution of the rs1695 A/G **(A)** and rs1138272 C/T **(B)**.
CRC = colorectal cancer

*GSTP1* genotypic count of the overall participants for rs1695 and rs1138272. The p-values and odds ratio (OR) displayed in the figure correspond to pairwise comparisons of genotypes in between the two groups. Lines typically represent trends or connections between data points and square dots mark data points or average. Genotype count means number of individuals with a specific genetic variation.
CI = confidence interval

TABLE 3.

Frequency of GSTP1 (rs1695) polymorphism and its association with colorectal cancer (CRC) risk

Models/Genotype	CRC Patients + Healthy Controls n (%)	CRC Patients n (%)	Healthy Controls n (%)	OR	P Value	95% CI	RR
Overall Subjects
Codominant Model
A/A	192 (43)	91 (46)	101 (40)		Referent		^_
A/G	231 (51)	102 (51)	129 (52)	0.88	0.10	0.60–1.29	1.2
G/G	27 (6)	07 (4)	20 (8)	0.39	0.10	0.16–0.97	0.2
Dominant Model (A/G+G/G)	258 (57)	109 (54)	149 (60)	0.81	0.28	0.56–1.19	1.4
Recessive Model (A/A+A/G)	423	193	230	2.39	0.05*	0.99–5.79	-
Over dominant Model (A/G)	231 (51)	102 (51)	129 (52)	1.02	0.89	0.70–1.48	-
Male
A/A	123 (42)	58 (48)	65 (38)		Referent		^_
A/G	150 (52)	63 (52)	87 (51)	0.81	< 0.01*	0.50–1.31	1.3
G/G	18 (6)	01 (0.1)	17 (1)	0.07	< 0.01*	0.01–0.51	0.2
Dominant Model (A/G+G/G)	168 (58)	64 (52)	104 (52)	0.69	0.12	0.43–1.11	1.5
Female
A/A	69 (43)	33 (42)	36 (44)		Referent		^_
A/G	81 (51)	39 (50)	42 (52)	1.01	0.55	0.53–1.93	1.1
G/G	9 (6)	06 (8)	03 (4)	2.18	0.55	0.50–9.43	0.1
Dominant Model (A/G+G/G)	90 (57)	45 (58)	45 (56)	1.09	0.79	0.58–2.04	1.2
HWE (Genotype Frequencies)
A²	0.46	0.50	0.436	-	-	-
2AG	0.43	0.41	0.449	-	-	-
G²	0.10	0.08	0.116	-	-	-
χ²total = 1

* Statistically significant associations (p ≤ 0.05), Logistic regression model adjusted by age, gender and smoking;

1 CI = confidence interval; CRC = colorectal cancer; OR = odd ratio; RR = relative risk

TABLE 4.

Frequency of GSTP1(rs1138272) polymorphism and its association with colorectal cancer (CRC) risk

Models/Genotype	CRC Patients +Healthy Controls n (%)	CRC Patients n (%)	Healthy Controls n (%)	OR	P Value	95% CI	RR
Overall Subjects
Codominant Model
C/C	350 (78)	161(80)	189(76)		Referent		^_
C/T	90 (20)	35(18)	55(22)	0.74	0.12	0.46-1.19	0.2
T/T	10 (2)	4(2)	6 (2)	0.78	0.70	0.21-2.82	0.03
Dominant Model C/T+T/T	100 (22)	39 (19)	61 (24)	0.75	0.21	0.47-1.18	0.3
Recessive Model (C/C+C/T)	440	196	244	1.20	0.77	0.33-4.32	-
Over dominant Model
(C/T)	90 (20)	35(18)	55(22)	0.75	0.23	0.46-1.20	-
Male
C/C	229(79)	98(80)	131(78)		Referent		-
C/T	56(19)	20(17)	36(21)	0.74	0.33	0.40-1.36	0.2
T/T	6(2)	4(3)	02(1)	2.67	0.26	0.47-14.89	0.02
Dominant Model C/T+T/T	62(21)	24(20)	38(22)	0.84	0.56	0.47-1.49	0.2
Female
C/C	121(76)	61(78)	60(74)		Referent		^_
C/T	34(21)	15(19)	19(24)	0.77	0.51	0.36-1.66	0.3
T/T	4(3)	2(3)	02(2)	0.98	0.98	0.13-7.21	0.04
Dominant Model C/T+T/T	38(24)	17(22)	21(26)	0.88	0.74	0.43-1.82	0.3
HWE (Genotype Frequencies)
C²	0.462	0.81	0.25	-	-	-	-
2CT	0.435	0.18	0.5	-	-	-	-
T²	0.102	0.01	0.25	-	-	-	-
χ²total = 1

* Statistically significant associations (p ≤ 0.05), Logistic regression model adjusted by age, gender and smoking.

1 CI = confidence interval; CRC = colorectal cancer; OR = odd ratio; RR = relative risk

TABLE 5.

Frequency of PTEN (rs701848) polymorphism and its association with colorectal cancer (CRC) risk

Models/Genotype	CRC Patients +Healthy Controls n (%)	CRC Patients n (%)	Healthy Controls n (%)	OR	P Value	95% CI	RR
Overall Subjects
Codominant Model
T/T	293 (65)	136 (68)	157 (63)		Referent		^_
T/C	113 (25)	30 (15)	83 (33)	0.41	0.03*	0.25–0.67	0.5
C/C	44 (10)	34 (17)	10 (4)	3.92	0.03*	1.86– 8.23	0.06
Dominant
T/C+C/C	157 (35)	64 (32)	93 (37)	0.79	0.25	0.53–1.17	0.5
Recessive Model (T/T+T/C)	406	166	240	0.20	< 0.01*	0.09–0.42	-
Over dominant Model
(T/C)	113 (25)	30 (15)	83 (33)	0.35	< 0.01*	0.22–0.56	-
Male
T/T	197 (68)	86 (70)	111 (66)		Referent
T/C	71 (24)	17 (14)	54 (32)	0.40	0.04*	0.21–0.75	^_
C/C	23 (8)	19 (16)	04 (2)	8.02	0.01*	2.29-28.01	0.04
Dominant
T/C+C/C	94 (32)	36 (30)	58 (34)	0.81	0.42	0.49–1.35	0.5
Female
T/T	96 (60)	50 (64)	46 (57)		Referent		^_
T/C	42 (27)	13 (17)	29 (36)	0.41	0.02*	0.19–0.89	0.6
C/C	21 (13)	15 (19)	06 (7)	2.05	0.14	0.77-5.48	0.1
Dominant T/C+C/C	63 (40)	28 (36)	35 (43)	0.72	0.32	0.38–1.36	0.7
HWE (Genotype Frequencies)
T²	0.04	0.04	0.03	-	-	-
2TC	0.34	0.32	0.29	-	-	-
C²	0.60	0.64	0.67	-	-	-
χ²total = 1

* Statistically significant associations (p < 0.05), Logistic regression model adjusted by age, gender, and smoking.

1 CI = confidence interval; CRC = colorectal cancer; OR = odd ratio; RR = relative risk

*PTEN* genotypic count of the overall participants for rs701848 and rs2735343. The p-values and odds ratio (OR) displayed in the figure correspond to pairwise comparisons of genotypes between the two groups in each of the bar graphs. Lines typically represent trends or connections between data points and square dots mark data points or average. Genotype count means number of individuals with a specific genetic variation.
CI = confidence interval

*PTEN* Alleles frequency distribution of the rs701848 T/C **(A)** and rs2735343 C/G **(B)**.
CRC = colorectal cancer

TABLE 6.

Frequency of PTEN (rs2735343) polymorphism and its association with colorectal cancer (CRC) risk

Models/Genotype	CRC Patients +Healthy Controls n (%)	CRC Patients n (%)	Healthy Controls n (%)	OR	P Value	95% CI	RR
Overall Subjects
Codominant Model
C/C	215 (48)	40 (20)	175 (70)		Referent		^_
C/G	77 (17)	35 (18)	42 (17)	3.6	< 0.01*	2.06–6.42	0.2
G/G	158 (35)	125 (62)	33 (13)	17.0	< 0.01*	10.0–28.0	0.1
Dominant
C/G+G/G	235 (52)	160 (80)	75 (30)	9.5	< 0.01*	6.10–14.7	0.4
Recessive Model (C/C+C/G)	292	75	217	0.09	< 0.01*	0.05–0.14	-
Over dominant Model
(C/G)	77 (17)	35 (18)	42 (17)	1.09	0.71	0.67–1.79	-
Male
C/C	139 (48)	24 (20)	115 (68)		Referent		^_
C/G	47 (16)	16 (13)	31 (18)	2.47	< 0.01*	1.17–5.22	0.2
G/G	105 (36)	82 (67)	23 (14)	17.08	< 0.01*	9.02–32.3	0.2
Dominant
C/G+G/G	152 (52)	98 (80)	54 (32)	8.70	< 0.01*	5.01–15.0	0.4
Female
C/C	76 (48)	16 (21)	60 (74)		Referent		^_
C/G	30 (19)	19 (24)	11 (14)	6.48	< 0.01*	2.57–16.3	0.1
G/G	53 (33)	43 (55)	10 (12)	16.12	< 0.01*	6.68–38.9	0.1
Dominant
C/G+G/G	83 (52)	62(79)	21 (26)	11.07	< 0.01*	5.28–23.3	0.3
HWE (Genotype Frequencies)
C²	0.12	0.24	0.05	-	-	-
2CG	0.45	0.5	0.35	-	-	-
G²	0.42	0.26	0.59	-	-	-
χ²total = 1

* Statistically significant associations (p < 0.05), Logistic regression model adjusted by age, gender and smoking.

1 CI = confidence interval; CRC = colorectal cancer; OR = od Ratio; RR = relative risk

TABLE 7.

Association of GSTP1 and PTEN polymorphism with colon and rectum cancer cases

Gene/rs	Genotype	Colon n = 102 (%)	Rectum n = 98 (49%)	P Value
GSTP1 rs1695	AA	62 (61.11)	26 (27.00)	Referent
	AG	34 (33.33)	72 (73.33)	< 0.01*
	GG	06 (5.65)	-	0.25
GSTP1 rs1138272	CC	91 (89)	69 (69.5)	Referent
	CT	13 (13.0)	17 (17.3)	< 0.01*
	TT	17 (17.0)	17 (17.3)	0.27
PTEN rs701848	TT	72 (70.0)	64 (65.4)	Referent
	TC	13 (13.0)	17 (17.3)	< 0.01*
	CC	17 (17.0)	17 (17.3)	0.02
PTEN rs2735343	CC	20 (19.6)	20 (20.4)	Referent
	CG	19 (18.6)	16 (16.3)	0.71
	GG	63(61.8)	62 (63.3)	0.96

* Statistically significant associations (p < 0.05)

Articles in this issue

DOI: https://doi.org/10.2478/raon-2025-0001 | Journal eISSN: 1581-3207 | Journal ISSN: 1318-2099

Journal RSS Feed

Language: English

Page range: 110 - 120

Submitted on: Jul 12, 2024

Accepted on: Oct 25, 2024

Published on: Jan 4, 2025

Published by: Association of Radiology and Oncology

In partnership with: Paradigm Publishing Services

Publication frequency: 4 issues per year

Keywords:

colorectal cancer,

GSTP1,

PTEN,

Related subjects:

© 2025 Durr-e-Shahwar, Hina Zubair, Muhammad Kashif Raza, Zahid Khan, Lamjed Mansour, Aktar Ali, Muhammad Imran, published by Association of Radiology and Oncology
This work is licensed under the Creative Commons Attribution 4.0 License.

Volume 59 (2025): Issue 1 (March 2025)

Investigation of GSTP1 and PTEN gene polymorphisms and their association with susceptibility to colorectal cancer

Figures & Tables

TABLE 1.

TABLE 2.

FIGURE 1.

FIGURE 2.

TABLE 3.

TABLE 4.

TABLE 5.

FIGURE 4.

FIGURE 3.

TABLE 6.

TABLE 7.

Paradigm

My account