Have a personal or library account? Click to login
Investigation of GSTP1 and PTEN gene polymorphisms and their association with susceptibility to colorectal cancer Cover

Investigation of GSTP1 and PTEN gene polymorphisms and their association with susceptibility to colorectal cancer

Radiology and Oncology
Volume 59 (2025): Issue 1 (March 2025)
By: Durr-e-Shahwar,  Hina Zubair,  Muhammad Kashif Raza,  Zahid Khan,  Lamjed Mansour,  Aktar Ali and  Muhammad Imran  
Open Access
|Jan 2025

Figures & Tables

FIGURE 1.

GSTP1Alleles frequency distribution of the rs1695 A/G (A) and rs1138272 C/T (B). CRC = colorectal cancer

FIGURE 2.

GSTP1 genotypic count of the overall participants for rs1695 and rs1138272. The p-values and odds ratio (OR) displayed in the figure correspond to pairwise comparisons of genotypes in between the two groups. Lines typically represent trends or connections between data points and square dots mark data points or average. Genotype count means number of individuals with a specific genetic variation. CI = confidence interval

FIGURE 4.

PTEN genotypic count of the overall participants for rs701848 and rs2735343. The p-values and odds ratio (OR) displayed in the figure correspond to pairwise comparisons of genotypes between the two groups in each of the bar graphs. Lines typically represent trends or connections between data points and square dots mark data points or average. Genotype count means number of individuals with a specific genetic variation. CI = confidence interval

FIGURE 3.

PTEN Alleles frequency distribution of the rs701848 T/C (A) and rs2735343 C/G (B). CRC = colorectal cancer

Frequency of PTEN (rs2735343) polymorphism and its association with colorectal cancer (CRC) risk

Models/GenotypeCRC Patients +Healthy Controls n (%)CRC Patients n (%)Healthy Controls n (%)ORP Value95% CIRR
Overall Subjects
Codominant Model
  C/C215 (48)40 (20)175 (70) Referent _
  C/G77 (17)35 (18)42 (17)3.6< 0.01*2.06–6.420.2
  G/G158 (35)125 (62)33 (13)17.0< 0.01*10.0–28.00.1
Dominant
  C/G+G/G235 (52)160 (80)75 (30)9.5< 0.01*6.10–14.70.4
Recessive Model (C/C+C/G)292752170.09< 0.01*0.05–0.14-
Over dominant Model
  (C/G)77 (17)35 (18)42 (17)1.090.710.67–1.79-
Male
  C/C139 (48)24 (20)115 (68) Referent _
  C/G47 (16)16 (13)31 (18)2.47< 0.01*1.17–5.220.2
  G/G105 (36)82 (67)23 (14)17.08< 0.01*9.02–32.30.2
Dominant
  C/G+G/G152 (52)98 (80)54 (32)8.70< 0.01*5.01–15.00.4
Female
  C/C76 (48)16 (21)60 (74) Referent _
  C/G30 (19)19 (24)11 (14)6.48< 0.01*2.57–16.30.1
  G/G53 (33)43 (55)10 (12)16.12< 0.01*6.68–38.90.1
Dominant
  C/G+G/G83 (52)62(79)21 (26)11.07< 0.01*5.28–23.30.3
HWE (Genotype Frequencies)
  C20.120.240.05---
  2CG0.450.50.35---
  G20.420.260.59---
  χ2total = 1

Frequency of PTEN (rs701848) polymorphism and its association with colorectal cancer (CRC) risk

Models/GenotypeCRC Patients +Healthy Controls n (%)CRC Patients n (%)Healthy Controls n (%)ORP Value95% CIRR
Overall Subjects
Codominant Model
  T/T293 (65)136 (68)157 (63) Referent _
  T/C113 (25)30 (15)83 (33)0.410.03*0.25–0.670.5
  C/C44 (10)34 (17)10 (4)3.920.03*1.86– 8.230.06
Dominant
  T/C+C/C157 (35)64 (32)93 (37)0.790.250.53–1.170.5
Recessive Model (T/T+T/C)4061662400.20< 0.01*0.09–0.42-
Over dominant Model
  (T/C)113 (25)30 (15)83 (33)0.35< 0.01*0.22–0.56-
Male
  T/T197 (68)86 (70)111 (66) Referent
  T/C71 (24)17 (14)54 (32)0.400.04*0.21–0.75_
  C/C23 (8)19 (16)04 (2)8.020.01*2.29-28.010.04
Dominant
  T/C+C/C94 (32)36 (30)58 (34)0.810.420.49–1.350.5
Female
  T/T96 (60)50 (64)46 (57) Referent _
  T/C42 (27)13 (17)29 (36)0.410.02*0.19–0.890.6
  C/C21 (13)15 (19)06 (7)2.050.140.77-5.480.1
Dominant T/C+C/C63 (40)28 (36)35 (43)0.720.320.38–1.360.7
HWE (Genotype Frequencies)
  T20.040.040.03---
  2TC0.340.320.29---
  C20.600.640.67---
  χ2total = 1

Association of GSTP1 and PTEN polymorphism with colon and rectum cancer cases

Gene/rsGenotypeColon n = 102 (%)Rectum n = 98 (49%)P Value
GSTP1 rs1695AA62 (61.11)26 (27.00)Referent
AG34 (33.33)72 (73.33)< 0.01*
GG06 (5.65)-0.25
GSTP1 rs1138272CC91 (89)69 (69.5)Referent
CT13 (13.0)17 (17.3)< 0.01*
TT17 (17.0)17 (17.3)0.27
PTEN rs701848TT72 (70.0)64 (65.4)Referent
TC13 (13.0)17 (17.3)< 0.01*
CC17 (17.0)17 (17.3)0.02
PTEN rs2735343CC20 (19.6)20 (20.4)Referent
CG19 (18.6)16 (16.3)0.71
GG63(61.8)62 (63.3)0.96

Primer sequences and amplification conditions for GSTP1 and PTEN polymorphisms

GenePrimer sequencePCR conditionsAmplicon length (bp)Restriction enzymeLength of digest products (bp)Enzyme specificity
GSTP1 (rs1695)F:5′GGCTCTATGGGAAGGACCAGCAGG-3′ R:5′GCACCTCCATCCAGAAACTGGCG3′30 cycles of 1 min at 94°C,1 min at 66°C and 2 min at 72°C.445Alw261330+115+2705’GTCTC(N)1↓3’3’CAGAG(N) 5↑5’
GSTP1 (rs1138272)F:5′CAGCAGAGGCAGCGTGTGTGC-3′ R:5′CCCACAATGAAGGTCTTGCCTCC-3′30 cycles of 1 min at 94°C, 1 min at 64°C and 2 min at 72°C.565AciI365+120+485+805’C↓CG↑C’3 3’G↓GC↑G’5
PTEN (rs701848)F:5’-GTGCTTTATTGATTTGCT-3’ R:5’AGTAGTTGTACTCCGCTT-3’5 min at 94°C, 35 cycles of 30 s at 94°C, 30 s at 55°C, 30 s at 72°C, and10 min extension at 72°C.199HaeIII199+81+1185’GG↑CC3’3’CC↑G G5’
PTEN (rs2735343)F:5’-CTCTTCCTGTTCTCCATCGTG-3’ R:5’-TTCTCCAGGATTTCGTCTGC-3’5 min at 94°C, 35 cycles of 30 s at 94°C, 30 s at 63°C, 30 s at 72°C and 10 min at 72°C.272HhaI272+72+2005’G↑CG↑C3’ 3’C↑GC↑G’5

Frequency of GSTP1 (rs1695) polymorphism and its association with colorectal cancer (CRC) risk

Models/GenotypeCRC Patients + Healthy Controls n (%)CRC Patients n (%)Healthy Controls n (%)ORP Value95% CIRR
Overall Subjects
Codominant Model
A/A192 (43)91 (46)101 (40) Referent _
A/G231 (51)102 (51)129 (52)0.880.100.60–1.291.2
G/G27 (6)07 (4)20 (8)0.390.100.16–0.970.2
Dominant Model (A/G+G/G)258 (57)109 (54)149 (60)0.810.280.56–1.191.4
Recessive Model (A/A+A/G)4231932302.390.05*0.99–5.79-
Over dominant Model (A/G)231 (51)102 (51)129 (52)1.020.890.70–1.48-
Male
A/A123 (42)58 (48)65 (38) Referent _
A/G150 (52)63 (52)87 (51)0.81< 0.01*0.50–1.311.3
G/G18 (6)01 (0.1)17 (1)0.07< 0.01*0.01–0.510.2
Dominant Model (A/G+G/G)168 (58)64 (52)104 (52)0.690.120.43–1.111.5
Female
A/A69 (43)33 (42)36 (44) Referent _
A/G81 (51)39 (50)42 (52)1.010.550.53–1.931.1
G/G9 (6)06 (8)03 (4)2.180.550.50–9.430.1
Dominant Model (A/G+G/G)90 (57)45 (58)45 (56)1.090.790.58–2.041.2
HWE (Genotype Frequencies)
A20.460.500.436---
2AG0.430.410.449---
G20.100.080.116---
χ2total = 1

Demographic information and risk factors in colorectal cancer (CRC) cases and control

VariablePatients N = 200(%)Control n = 250(%)P value
*Age (Years)
≥ 40132 (66.0)151 (60.4)0.222
< 4068 (34.0)99 (39.6)
Range10-6011-60-
Median4632-
*Gender
Male122 (61.1)169(68)0.273
Female78 (39.0)81(32)
**Smoking status
Never165 (82.3)22 (8.8)< 0.010
Ever35 (17.6)228 (91.1)
*Site of tumor
Colon102(51.00)0.984
Rectum98(49.00)

Frequency of GSTP1(rs1138272) polymorphism and its association with colorectal cancer (CRC) risk

Models/GenotypeCRC Patients +Healthy Controls n (%)CRC Patients n (%)Healthy Controls n (%)ORP Value95% CIRR
Overall Subjects
Codominant Model
  C/C350 (78)161(80)189(76) Referent _
  C/T90 (20)35(18)55(22)0.740.120.46-1.190.2
  T/T10 (2)4(2)6 (2)0.780.700.21-2.820.03
Dominant Model C/T+T/T100 (22)39 (19)61 (24)0.750.210.47-1.180.3
Recessive Model (C/C+C/T)4401962441.200.770.33-4.32-
Over dominant Model
  (C/T)90 (20)35(18)55(22)0.750.230.46-1.20-
Male
  C/C229(79)98(80)131(78) Referent -
  C/T56(19)20(17)36(21)0.740.330.40-1.360.2
  T/T6(2)4(3)02(1)2.670.260.47-14.890.02
Dominant Model C/T+T/T62(21)24(20)38(22)0.840.560.47-1.490.2
Female
  C/C121(76)61(78)60(74) Referent _
  C/T34(21)15(19)19(24)0.770.510.36-1.660.3
  T/T4(3)2(3)02(2)0.980.980.13-7.210.04
Dominant Model C/T+T/T38(24)17(22)21(26)0.880.740.43-1.820.3
HWE (Genotype Frequencies)
  C20.4620.810.25----
  2CT0.4350.180.5----
  T20.1020.010.25----
  χ2total = 1
DOI: https://doi.org/10.2478/raon-2025-0001 | Journal eISSN: 1581-3207 | Journal ISSN: 1318-2099
Journal RSS Feed
Language: English
Page range: 110 - 120
Submitted on: Jul 12, 2024
|
Accepted on: Oct 25, 2024
|
Published on: Jan 4, 2025
Published by: Association of Radiology and Oncology
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year
Keywords:
colorectal cancer,
GSTP1,
PTEN,
polymorphism,
PCR-RFLP
Related subjects:
Medicine,
Clinical medicine,
Internal medicine,
Haematology, oncology,
Radiology

© 2025 Durr-e-Shahwar, Hina Zubair, Muhammad Kashif Raza, Zahid Khan, Lamjed Mansour, Aktar Ali, Muhammad Imran, published by Association of Radiology and Oncology
This work is licensed under the Creative Commons Attribution 4.0 License.

Previous articleVolume 59 (2025): Issue 1 (March 2025)Next article