Fig. 1.
Fig. 2.
Fig. 3.
Fig. 4.
Effect of Radix Paeoniae Rubra aqueous extract (RPRE) on the proliferation of E_ coli O101
| RPRE (mg/mL) | Bacterial growth rate (%) |
|---|---|
| 0 | 100.00 ± 0.00 |
| 1 | 86.75 ± 0.37 |
| 2 | 87.68 ± 0.33 |
| 4 | 84.66 ± 0.15 |
| 8 | 85.36 ± 0.40 |
| 16 | 85.15 ± 0.19 |
| 32 | 85.81 ± 0.40 |
| 64 | 75.71 ± 0.33 |
| 128 | 70.61 ± 0.36 |
Primer sequences used in a qRT-PCR for analysing expression of E_ coli O101 genes after treatment with Radix Paeoniae Rubra aqueous extract
| Gene | Primer | Sequence (5ʹ–3ʹ) | Length (bp) |
|---|---|---|---|
| marA | marA-F | TTCATAGCATTTTGGACTGG | 158 |
| soxS | soxS-F | TGACGCATCAGACGCTTGGC | 188 |
| ompC | ompC-F | GGTGGCTGGGGGGTAGATACTGG | 184 |
| ompF | ompF-F | ACCTGGCAGCGAACTACG | 174 |
| 16S | 16S-F | AACTCTGTTATTAGGGAAGAACA | 196 |
Minimum inhibitory concentrations (MIC) of antibiotics against E_ coli O101 used with Radix Paeoniae Rubra aqueous extract
| Type | Antibiotic | MIC (μg/mL) | CLSI M100 33rd edition E. coli breakpoint (μg/mL) | Low resistance (R ≤ MIC < 2R) (μg/mL)† | Moderate resistance (2R ≤ MIC < 4R) (μg/mL)† | High resistance (MIC ≥ 4R) (μg/mL)† | Noted resistance | ||
|---|---|---|---|---|---|---|---|---|---|
| S | I | R | |||||||
| Aminoglycosides | Gentamicin | 16 | ≤4 | 8 | ≥16 | 16–31 | 32–63 | ≥64 | Low |
| Kanamycin | 128 | ≤16 | 32 | ≥64 | 64–127 | 128–255 | ≥256 | Moderate | |
| Streptomycin | 32 | — | — | — | Moderate‡ | ||||
| Spectinomycin | 128 | ≤32 | 64 | ≥128 | 128–255 | 256–511 | ≥512 | Low | |
| Tetracyclines | Tetracycline hydrochloride | 16 | ≤4 | 8 | ≥16 | 16–31 | 32–63 | ≥64 | Low |
| Doxycycline | 16 | ≤4 | 8 | ≥16 | 16–31 | 32–63 | ≥64 | Low | |
| Cephalosporins | Cephalexin | 64 | ≤8 | 16 | ≥32 | 32–63 | 64–127 | ≥128 | Moderate |
| Sulphonamides | Sulphadimethoxine§ | >256 | ≤256 | — | ≥512 | 512–1,023 | 1,024–2,047 | ≥2,048 | Low |
| Macrolides | Tilmicosin | >256 | — | — | ≥16 | 16–31 | 32–63 | ≥64 | High |
| Amphenicols | Florfenicol | 16 | ≤8 | — | ≥16 | 16–31 | 32–63 | ≥64 | Low |
| Quinolones | Enrofloxacin | 16 | ≤1 | — | ≥4 | 4–7 | 8–16 | ≥16 | High |