Have a personal or library account? Click to login
Molecular analysis of Anaplasma ovis, Theileria ovis and Brucella abortus in adult Ornithodoros lahorensis soft ticks (Acari: Ixodida: Argasidae) isolated from the Xinjiang Uygur Autonomous Region, China Cover

Molecular analysis of Anaplasma ovis, Theileria ovis and Brucella abortus in adult Ornithodoros lahorensis soft ticks (Acari: Ixodida: Argasidae) isolated from the Xinjiang Uygur Autonomous Region, China

Open Access
|Sep 2024

Figures & Tables

Fig. 1.

Map of the Xinjiang Uygur Autonomous Region (XUAR), China. The black dots indicate localities where samples were collected

Fig. 2.

The phylogenetic analysis of Anaplasma ovis identified in this study based on the Msp4 gene sequences. The tree was constructed using the maximum likelihood method. The numbers at nodes represent the percentage occurrence of the clade in 1,000 bootstrap replications. The sequence from this study is indicated by a black dot

Fig. 3.

The phylogenetic analysis of Theileria ovis identified in this study based on the 18S rRNA gene sequences. The tree was constructed using the maximum likelihood method. The numbers at nodes represent the percentage occurrence of the clade in 1,000 bootstrap replications. The sequence from this study is indicated by a black dot

Fig. 4.

The phylogenetic analysis of Brucella abortus identified in this study based on the Omp22 gene sequences. The tree was constructed using the maximum likelihood method. The numbers at nodes represent the percentage occurrence of the clade in 1,000 bootstrap replications. The sequence from this study is indicated by a black dot

Prevalence of pathogens detected in Ornithodoros lahorensis soft ticks in the Xinjiang Uygur Autonomous Region, China

Prevalence (%)
PathogenShanshan (n = 209)Awat (n = 93)Hejing (n = 24)Yutian (n = 20)Qira (n = 20)Overall (n = 366)
Anaplasma ovis28.2 (59/209)23.6 (22/93)0 (0/24)40.0 (8/20)10.0 (2/20)24.9 (91/366)
Theileria ovis45.0 (94/209)35.5 (33/93)0 (0/24)0 (0/20)0 (0/20)34.7 (127/366)
Brucella abortus24.4 (51/209)39.8 (37/93)25.0 (6/24)0 (0/20)0 (0/20)25.6 (94/366)

Prevalence of single and co-infection with one or more of Anaplasma ovis, Theileria ovis and Brucella abortus in Ornithodoros lahorensis soft ticks in the Xinjiang Uygur Autonomous Region, China

PathogenNumber of positive samples/percentage (%)
Single infectionAnaplasma ovis54/366 (14.8)
Theileria ovis83/366 (22.7)
Brucella abortus63/366 (17.2)
Co-infectionA. ovis + T. ovis25/366 (6.8)
T. ovis + B. abortus19/366 (5.2)
A. ovis + B. abortus12/366 (3.3)
A. ovis + T. ovis + B. abortus0/366 (0)

PCR amplification of genetic material of pathogens isolated from Ornithodoros lahorensis soft ticks in the Xinjiang Uygur Autonomous Region, China

PathogenTarget gene/regionPrimer (5′–3′)EPS (base pairs)AT (°C)Reference
Anaplasma ovisMsp4Forward: CGCCTGCTCCCTACTTGTT32258(13)
Reverse: TTCCACTCTGGCTCCTCCT
Theileria ovis18S rRNAForward: TCGAGACCTTCGGGT52052(1)
Reverse: TCCGGACATTGTAAAACAAA
Brucella abortusOmp2Forward: TGATGGGAGGGACCGACTA49455(24)
Reverse: TGGTTCTTCAGGTTGTTACGC

Collection of Ornithodoros lahorensis soft tick samples in the Xinjiang Uygur Autonomous Region, China

Collection dateCollection seasonRegionNumber of samples collectedAltitude (m), latitude and longitude
Oct. 2020 and Mar. 2021Autumn and springShanshan209979; 42°82′ N, 90°25′ E
Mar.–Apr. 2021SpringAwat931028; 40°76′ N, 80°25′ E
Oct. 2019AutumnHejing241100; 42°32′ N, 86°38′ E
Mar. 2022SpringYutian201628; 36°41′ N, 81°29′ E
Mar. 2022SpringQira201361; 37°3′ N, 80°46′ E
Language: English
Page range: 355 - 361
Submitted on: Feb 21, 2024
|
Accepted on: Sep 3, 2024
|
Published on: Sep 23, 2024
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2024 Dandan Liu, Jinming Wang, Yutong Liu, Shuiyi Wang, Huiru Zhu, Bingbing Jiang, Yongchang Li, Yang Zhang, Bayin Chahan, Wei Zhang, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.