Skip to main content
Have a personal or library account? Click to login
Molecular analysis of Anaplasma ovis, Theileria ovis and Brucella abortus in adult Ornithodoros lahorensis soft ticks (Acari: Ixodida: Argasidae) isolated from the Xinjiang Uygur Autonomous Region, China Cover

Molecular analysis of Anaplasma ovis, Theileria ovis and Brucella abortus in adult Ornithodoros lahorensis soft ticks (Acari: Ixodida: Argasidae) isolated from the Xinjiang Uygur Autonomous Region, China

Open Access
|Sep 2024

Full Article

Introduction

As obligate blood-feeding arthropods, ticks are currently considered to be second only to mosquitoes as vectors of human, domestic and wild animal infectious diseases in the world, and they have caused significant economic losses in livestock farming and threatened public health. Ticks are monophyletic and comprise the Ixodidae, Argasidae and Nuttalliellidae families, in which approximately 900 species have been identified worldwide. Up to the present time, approximately 10% of the tick species currently known have been reported to act as vectors of numerous pathogens, including viruses, bacteria, protozoa and helminths. Generally, each tick species has its preferred environmental conditions and biotopes, which distributes ticks and the risk areas for particular tick-borne diseases heterogeneously over the world.

Besides the Ixodidae (hard ticks), the Argasidae (soft ticks) also have high medical significance. The Argasidae differ from the Ixodidae by having no scutum on the dorsum. This family survives at high temperatures and under relatively dry conditions, resists starvation, lives nidicolously in the nests, burrows and caves of vertebrate animals or in human and livestock habitations, and takes short-duration bloodmeals. The preference of Argasidae for sheltered microhabitats and their characteristically short blood feeding duration usually hides their presence, permitting their threat to human and animal health to generally be ignored. The Argasidae family is a complex and diverse assemblage of four genera and 183 species, namely Argas, Carios, Ornithodoros and Otobius, and at least 11 species in twc genera (Ornithodoros and Argas) have been reported in China. Typically, the argasid ticks of recognised medical and veterinary importance belong to the Argas, Ornithodoros and Otobius genera. As haematophagous arthropods, in addition to harming the host while sucking blood through causing, for instance, toxicosis, paralysis, irritation, allergies and blood loss, argasid ticks can spread a variety of tick-borne disorders, including human tick-borne relapsing fever, viral encephalitis, African swine fever, fowl spirochaetosis or anaplasmosis-like diseases and epizootic bovine abortion syndrome.

Ornithodoros lahorensis is a species of argasid tick which infests large domestic animals and can usually be collected from sheep, camels, cattle, goats, horses and donkeys. In these animal hosts, O. lahorensis can induce anaemia, toxic reactions and paralysis. More importantly, it has strong vectorial capacity for several pathogens. As far as we know, O. lahorensis may carry or transmit the Crimean–Congo haemorrhagic fever virus, Rickettsia sibirica, Rickettsia conorii, Brucella abortus, Francisella tularensis and Coxiella burnetii. However, there have been few relevant research undertakings into O. lahorensis and associated tick-borne pathogens in China, and pathogens of only three genera (i.e. Theileria spp., Anaplasma spp. and Babesia spp.) have been reported in studies so far.

The Xinjiang Uygur Autonomous Region (XUAR) is the largest administrative division of China, occupying one-sixth of its mainland and having an area of approximately 1,660,000 km2. It is halfway along the old Silk Road between eastern Asia and Europe and borders eight countries; therefore, international livestock trade is frequent in the XUAR. The complex geographical and diverse ecological environments, including the Gobi Desert, valleys, mountains, grassland and flatland, provide a natural habitat for ticks, making the XUAR one of the regions in China with the largest tick diversity.

Previous studies have mainly focused on ixodid ticks and ixodid tick–borne pathogens, and the potential threats of argasid ticks and argasid tick–borne pathogens to animal husbandry and public health have been underestimated. At least seven species of argasid tick have been identified in the XUAR alone, Ornithodoros lahorensis being the dominant one. In order to further investigate the vectorial capacity and pathogen burden of O. lahorensis, 366 adult O. lahorensis from five main habitats in the XUAR were collected and identified in the present study. In addition, molecular techniques were utilised to assess the presence of O. lahorensis-associated pathogens, namely Anaplasma ovis, Theileria ovis and Brucella abortus. To the best of our knowledge, this is the first experimental report of Brucella abortus in O. lahorensis from China.

Material and Methods
Tick collection

Adult O. lahorensis (n = 366) were collected in Shanshan County of Turpan City (n = 209), Awat County of Aksu City (n = 93), Hejing County of the Bayingolin Mongol Autonomous Prefecture (n = 24), and Yutian County (n = 20) and Qira County (n = 20) of Hetian City in the XUAR in China from October 2019 to March 2022 (Fig. 1 and Table 1). The samples were collected from the body surface (neck, back, axillary and thoracic regions) of sheep and were preserved in tubes containing moistened absorbent cotton. Subsequently, the samples were transported to the laboratory of the College of Veterinary Medicine at Xinjiang Agricultural University and identified by morphological and molecular methods. Briefly, preliminary identification was performed under a stereo microscope by the characteristics of the dorsal cuticle, anus, Haller’s organ, hypostome, spiracle and gonopore. Then the 16S rDNA genes of the ticks were amplified and the tick species were identified by sequence alignment.

Fig. 1.

Map of the Xinjiang Uygur Autonomous Region (XUAR), China. The black dots indicate localities where samples were collected

Table 1.

Collection of Ornithodoros lahorensis soft tick samples in the Xinjiang Uygur Autonomous Region, China

Collection dateCollection seasonRegionNumber of samples collectedAltitude (m), latitude and longitude
Oct. 2020 and Mar. 2021Autumn and springShanshan209979; 42°82′ N, 90°25′ E
Mar.–Apr. 2021SpringAwat931028; 40°76′ N, 80°25′ E
Oct. 2019AutumnHejing241100; 42°32′ N, 86°38′ E
Mar. 2022SpringYutian201628; 36°41′ N, 81°29′ E
Mar. 2022SpringQira201361; 37°3′ N, 80°46′ E
DNA isolation

Fasting tick samples were ultrasonically washed in 70% ethanol for 30 min and washed with phosphate-buffered saline solution for 10 min. After drying, the tick samples were put into a porcelain mortar with liquid nitrogen and ground to a fine powder. A TIANamp Genomic DNA Kit (Tiangen Biotech Co., Ltd, Beijing, China) was used to isolate genomic DNA of each tick, following the manufacturer’s instructions, and the resulting DNA samples were stored at -20°C until subsequent use.

Pathogen detection

All the samples were screened with species-specific primers for Anaplasma ovis, Theileria ovis and Brucella abortus by PCR analysis (Table 2). The PCR reaction mixture (25 μL) was composed of 1 μL of the stored DNA templates, 1 μL of forward and reverse primers (10 μM), 12 μL of 2× EasyTaq PCR SuperMix (TransGen Biotech, Beijing, China) and 10 μL of nuclease-free water. The PCR products were subjected to 1% agarose gel electrophoresis, stained with ethidium bromide and then visualised under UV light.

Table 2.

PCR amplification of genetic material of pathogens isolated from Ornithodoros lahorensis soft ticks in the Xinjiang Uygur Autonomous Region, China

PathogenTarget gene/regionPrimer (5′–3′)EPS (base pairs)AT (°C)Reference
Anaplasma ovisMsp4Forward: CGCCTGCTCCCTACTTGTT32258(13)
Reverse: TTCCACTCTGGCTCCTCCT
Theileria ovis18S rRNAForward: TCGAGACCTTCGGGT52052(1)
Reverse: TCCGGACATTGTAAAACAAA
Brucella abortusOmp2Forward: TGATGGGAGGGACCGACTA49455(24)
Reverse: TGGTTCTTCAGGTTGTTACGC

Msp 4 – major surface protein 4; 18S rRNA – 18 Svedberg ribosomal RNA; EPS – expected product size; AT – annealing temperature

Sequencing and phylogenetic analysis

All the evaluated amplification products were sequenced with an ABI PRISM 3730 XL DNA Analyzer (Applied Biosystems, Carlsbad, CA, USA), and the generated sequences were subsequently aligned using the NCBI nucleotide database (http://www.ncbi.nlm.nih.gov/nuccore/) and MEGA version X (20). In order to analyse the phylogenetic relationships, the gene sequences of Anaplasma ovis, Theileria ovis and Brucella abortus from different regions were downloaded from GenBank, and phylogenetic trees were constructed using the maximum likelihood algorithm in MEGA version X.

Results
Overall infection rate

The PCR assays revealed that out of the 366 samples, 256 (69.9%) carried one or two pathogens. Detailed tick-borne pathogen infection data are provided in Table 3. The highest rate was for infection with T. ovis at 34.7%, followed by the rate for infection with B. abortus at 25.6%), the A. ovis infection rate being 24.9%. The infection rates of the three pathogens showed obvious regional differences (Table 3).

Table 3.

Prevalence of pathogens detected in Ornithodoros lahorensis soft ticks in the Xinjiang Uygur Autonomous Region, China

Prevalence (%)
PathogenShanshan (n = 209)Awat (n = 93)Hejing (n = 24)Yutian (n = 20)Qira (n = 20)Overall (n = 366)
Anaplasma ovis28.2 (59/209)23.6 (22/93)0 (0/24)40.0 (8/20)10.0 (2/20)24.9 (91/366)
Theileria ovis45.0 (94/209)35.5 (33/93)0 (0/24)0 (0/20)0 (0/20)34.7 (127/366)
Brucella abortus24.4 (51/209)39.8 (37/93)25.0 (6/24)0 (0/20)0 (0/20)25.6 (94/366)
Co-infection analysis

Rate data for co-infection with two of the three pathogens were also analysed. No infection with all three pathogens simultaneously was detected. In total, 56 (15.3%) ticks bore two pathogens. The most common co-infection was with A. ovis and T. ovis, accounting for 6.8% of the 366 tick samples, followed by T. ovis + B. abortus (5.2%) and A. ovis + B. abortus (3.3%) (Table 4).

Table 4.

Prevalence of single and co-infection with one or more of Anaplasma ovis, Theileria ovis and Brucella abortus in Ornithodoros lahorensis soft ticks in the Xinjiang Uygur Autonomous Region, China

PathogenNumber of positive samples/percentage (%)
Single infectionAnaplasma ovis54/366 (14.8)
Theileria ovis83/366 (22.7)
Brucella abortus63/366 (17.2)
Co-infectionA. ovis + T. ovis25/366 (6.8)
T. ovis + B. abortus19/366 (5.2)
A. ovis + B. abortus12/366 (3.3)
A. ovis + T. ovis + B. abortus0/366 (0)
Comparative gene sequence analyses and phylogenetic analysis

All the tested amplicons of A. ovis, T. ovis and B. abortus were of the expected sizes of 322 bp, 520 bp or 494 bp, respectively, and all the sequences of a particular pathogen were identical. The major surface protein 4 (Msp4) gene sequence of A. ovis, the 18 Svedberg ribosomal RNA (18S rRNA) gene sequence of T. ovis and the outer membrane protein 22 gene sequence (Omp22) of B. abortus were all deposited to GenBank with the accession numbers OL769317, OL774380 and OL769318, respectively. Phylogenetic analysis indicated that the Msp4 gene sequence of A. ovis in this study and another three sequences of the same gene isolated from samples from different geographical regions grouped together in one clade, with identity of 99.65% (Fig. 2). Similarly, the 18S rRNA gene sequence of T. ovis in this study belonged to the same cluster as sequences from another eight isolates of T. ovis, with identity ranging from 99.58% to 100% (Fig. 3). Regarding the Omp22 gene sequence of B. abortus, the identity between OL769318 which was tested in this study and the Brucella abortus strains XUAR1 and XUAR2 was 100% (Fig. 4).

Fig. 2.

The phylogenetic analysis of Anaplasma ovis identified in this study based on the Msp4 gene sequences. The tree was constructed using the maximum likelihood method. The numbers at nodes represent the percentage occurrence of the clade in 1,000 bootstrap replications. The sequence from this study is indicated by a black dot

Fig. 3.

The phylogenetic analysis of Theileria ovis identified in this study based on the 18S rRNA gene sequences. The tree was constructed using the maximum likelihood method. The numbers at nodes represent the percentage occurrence of the clade in 1,000 bootstrap replications. The sequence from this study is indicated by a black dot

Fig. 4.

The phylogenetic analysis of Brucella abortus identified in this study based on the Omp22 gene sequences. The tree was constructed using the maximum likelihood method. The numbers at nodes represent the percentage occurrence of the clade in 1,000 bootstrap replications. The sequence from this study is indicated by a black dot

Discussion

As the dominant argasid tick species of the Ornithodoros genus in China, Ornithodoros lahorensis is widely distributed in the XUAR, especially in the regions around the Tarim Basin. As indicated by epidemiological investigation, O. lahorensis is mainly found in the Palaearctic region, including the five countries of central Asia, Russia, Georgia, Ukraine, Pakistan, Afghanistan, Iran, India and China (26, 34, 37). Regarding the ecology, the larvae of these ticks were reported to usually attach to hosts during the autumn or winter and the final nymph instars to moult to adults in the spring (15). In conformance with this seasonal pattern, according to Zhao et al. (41), O. lahorensis were collected from late February to early April in the XUAR – they only occurred in spring. However, in our research, besides their being found in spring, adult and nymph argasid ticks were also sampled in the autumn from the regions of Hejing and Shanshan (Table 1). Comparing annual temperature data for these two sampling sites, we found that the average temperatures in spring (4–18.5°C in March) and autumn (4–21°C in October) were almost the same, indicating that there might be two suitable seasons for O. lahorensis to moult to adults in the XUAR.

Anaplasma ovis is a tick-borne obligatory intraerythrocytic bacterium which can lead to ovine anaplasmosis, and usually infects sheep, goats and wild ruminants in tropical and subtropical regions. In general, the infection is subclinical; however, the acute phase can produce the symptoms of fever, progressive anaemia, icterus, weight loss and milk yield decrease, and can sometimes cause death (5). According to Chochlakis et al. (6), in 2007, a 27-year-old woman became infected with A. ovis after a tick bite in Cyprus, demonstrating that A. ovis is a zoonotic parasite. In 2018, O. lahorensis was first reported as a potential vector of A. ovis in the XUAR (41); however, the evidence was only derived from one sampling site of Uqturpan County of Aksu City, and the infection rate reports were lacking in detail. In this study, A. ovis was detected from O. lahorensis ticks collected from four sites around the Tarim Basin omitting Uqturpan, with a total carrier rate of 24.9%, which further indicated the important role for O. lahorensis as a vector of A. ovis. Among the five different sampling sites of Shanshan, Awat, Hejing, Yutian and Qira, O. lahorensis was only negative for A. ovis in Hejing. Further analysis found that only in the Hejing region was the sampling season the autumn, indicating that the A. ovis which was carried by O. lahorensis might be more prevalent in spring than in autumn.

Theileria ovis, a tick-borne haemoprotozoan parasite, is a global livestock pathogen that can cause ovine theileriosis, which is a significant infectious disease affecting small ruminants (2). In China, T. ovis was first reported in 2011 in the XUAR, when its transmission vector was demonstrated to be Hyalomma anatolicum anatolicum (22). Zhao et al. (43) first found T. ovis in O. lahorensis from the southern part of the XUAR in 2020, and revealed that the infection rates were 42.86% in Kashgar and 26% in Aksu. Subsequently, Li et al. (21) confirmed that T. ovis was distributed in the southern part of the XUAR in 2023, but the infection rate of O. lahorensis with the parasite was only 1.5% (5/330). However, in the present study, the overall rate for this soft tick to bear T. ovis was 22.7% (83/366), which was in agreement with the data of Zhao et al. (43). Interestingly, in this study, O. lahorensis which were collected from Shanshan (45.0%) and Awat (35.5%) were positive for T. ovis, but specimens from the other three sampling areas were negative. The positive regions are at the lowest altitude among the five sampling areas; therefore, the reason for the different prevalence of T. ovis in different areas might be the altitude of the sampling sites. This potential correlation still needs further research.

Brucellosis is one of the most important zoonotic diseases caused by Gram-negative bacteria belonging to the Brucella genus (8). Among all Brucella species, B. melitensis and B. abortus are the most pathogenic and virulent (10, 11, 18). As the main intracellular causative pathogen of brucellosis in cattle, Brucella abortus generally causes abortion and infertility in adult animals and is also an important cause of chronic infection in humans (7). According to Balashov (4) and Rodríguez et al. (31) Brucella could be cultivated from multiple tick species. Additionally, B. abortus which was cultivated from Boophilus annulatus hard ticks could be recultivated from the blood and organs of guinea pigs infected by tick bite (36). Similarly, Wang et al. (38) demonstrated that there was transovarial transmission of Brucella in Dermacentor marginatus. However, the current data are too scarce to clarify the relationship between B. abortus and Argasidae. According to Philip and Burgdorfer (29), in 1955 fasting O. lahorensis were found infected with Brucella abortus in areas where infected sheep had been kept one year before. Also, in 1962 the preservation of vaccinal strains of B. abortus 19-BA in O. lahorensis was reported (32). Since then, there has been no relevant experiment evidence found to demonstrate the relationship between O. lahorensis and Brucella. In 2020, Li et al. (24) tested 12 Ixodidae species collected from six counties in the XUAR and found that the infection rate with Brucella spp. was 26.2%. The present study gave a similar finding in Argasidae ticks: we found that O. lahorensis were positive for B. abortus in Shanshan, Awat and Hejing in the XUAR with an overall infection rate of 25.6%. Interestingly, B. abortus was not detected from the tick samples collected in Yutian and Qira, which had relatively high altitude and low latitude compared with the other regions.

Mixed infections of O. lahorensis involving more than one pathogen were observed in the present study. Most co-infections were caused by A. ovis + T. ovis or T. ovis + B. abortus. Although clinical cases were not observed in any of the sheep from which the O. lahorensis were collected, it is possible that animals infected with multiple pathogens may have more pronounced clinical signs or haematological abnormalities than those infected with single pathogens. It is suggested that A. ovis, B. abortus and T. ovis are potential pathogens that cause mixed infections in the sheep population of the XUAR.

Conclusion

This study revealed the existence of A. ovis, B. abortus and T. ovis in O. lahorensis collected from Shanshan, Awat, Hejing, Yutian and Qira, in the XUAR, China from October 2019 to March 2022. The current data determined the prevalence rates of the detected pathogens in O. lahorensis in that region and suggest the possible emergence of tick-borne diseases in local animals. This study also broadens the potential vector spectrum for these pathogens, and its findings imply that the role of Argasidae in disease transmission should not be ignored.

Language: English
Page range: 355 - 361
Submitted on: Feb 21, 2024
Accepted on: Sep 3, 2024
Published on: Sep 23, 2024
In partnership with: Paradigm Publishing Services

© 2024 Dandan Liu, Jinming Wang, Yutong Liu, Shuiyi Wang, Huiru Zhu, Bingbing Jiang, Yongchang Li, Yang Zhang, Bayin Chahan, Wei Zhang, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.