Have a personal or library account? Click to login
Effect of β-hydroxybutyrate acid on gene expression levels of antioxidant biomarkers and growth hormone–related genes in liver cell culture Cover

Effect of β-hydroxybutyrate acid on gene expression levels of antioxidant biomarkers and growth hormone–related genes in liver cell culture

Open Access
|Jun 2024

Figures & Tables

Fig. 1.

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on malondialdehyde (MDA) in hepatocytes at different time points
* – significant MDA concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)
Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on malondialdehyde (MDA) in hepatocytes at different time points * – significant MDA concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Fig. 2.

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on catalase (CAT) in hepatocytes at different time points
* – significant CAT concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value <0.05) at the same time point; ** – highly significant difference (P-value <0.01)
Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on catalase (CAT) in hepatocytes at different time points * – significant CAT concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value <0.05) at the same time point; ** – highly significant difference (P-value <0.01)

Fig. 3.

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on glutathione peroxidase (GSH-Px) in hepatocytes at different time points
* –significant GSH-Px concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)
Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on glutathione peroxidase (GSH-Px) in hepatocytes at different time points * –significant GSH-Px concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Fig. 4.

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on superoxide dismutase (SOD) in hepatocytes at different time points
* – significant SOD concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)
Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on superoxide dismutase (SOD) in hepatocytes at different time points * – significant SOD concentration difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Fig. 5.

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the gene expression level of catalase (CAT) messenger RNA (mRNA) in hepatocytes at different time points
* – significant CAT expression difference between BHBA concentration groups and the 0.0 mmol L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)
Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the gene expression level of catalase (CAT) messenger RNA (mRNA) in hepatocytes at different time points * – significant CAT expression difference between BHBA concentration groups and the 0.0 mmol L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Fig. 6.

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of glutathione peroxidase (GSH-Px) messenger RNA (mRNA) in hepatocytes at different time points
* – significant GSH-Px expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)
Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of glutathione peroxidase (GSH-Px) messenger RNA (mRNA) in hepatocytes at different time points * – significant GSH-Px expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Fig. 7.

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of superoxide dismutase (SOD) messenger RNA (mRNA) in hepatocytes at different time points
* – significant SOD expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)
Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of superoxide dismutase (SOD) messenger RNA (mRNA) in hepatocytes at different time points * – significant SOD expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Fig. 8.

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of growth hormone receptor (GHR) messenger RNA (mRNA) in hepatocytes at different time points
* – significant GHR expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)
Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of growth hormone receptor (GHR) messenger RNA (mRNA) in hepatocytes at different time points * – significant GHR expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Fig. 9.

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of insulin-like growth factor (IGF) messenger RNA (mRNA) in hepatocytes at different time points
* – significant IGF expression difference between BHBA concentration groups and the 0.0 mmol L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)
Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of insulin-like growth factor (IGF) messenger RNA (mRNA) in hepatocytes at different time points * – significant IGF expression difference between BHBA concentration groups and the 0.0 mmol L−1 BHBA concentration group (P-value < 0.05) at the same time point; ** – highly significant difference (P-value < 0.01)

Fig. 10.

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of insulin-like growth factor 1 receptor (IGF-1R) messenger RNA (mRNA) in hepatocytes at different time points
* – significant IGF-1R expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P value < 0.05) at the same time point; ** – highly significant difference (P-value <0.01)
Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the expression of insulin-like growth factor 1 receptor (IGF-1R) messenger RNA (mRNA) in hepatocytes at different time points * – significant IGF-1R expression difference between BHBA concentration groups and the 0.0 mmol·L−1 BHBA concentration group (P value < 0.05) at the same time point; ** – highly significant difference (P-value <0.01)

Primer sequences utilised in a reverse-transcriptase-PCR

GeneGenBank accession No.Primer sequences (5′–3′)Base pairs
GSH-PxNM_001101113.2Fwd GCGGGAGCAGGACTTCTACGARev CCCGATAGTGCTGGTCTGTGAA137
SODNM_201527.2Fwd TTCAATAAGGAGCAGGGACGRev CAGTGTAAGGCTGACGGTTT234
CATNM_001035386.1Fwd AGATACTCCAAGGCGAAGGTGRev AAAGCCACGAGGGTCACGAAC120
IGF-1NM_001077828.1Fwd TCGCATCTCTTCTATCTGGCCCTGTRev GCAGTACATCTCCAGCCTCCTCAGA101
IGF-1RNM_001244612.1Fwd TTAAAATGGCCAGAACCTGAGRev ATTATAACCAAGCCTCCCAC240
GHRNM_176608.1Fwd CCAGTTTCCATGGTTCTTAATTATRev TTCCTTTAATCTTTGGAACTGG138
β-actinNM_173979.3Fwd CTCTTCCAGCCTTCCTTCCTRev GGGCAGTGATCTCTTTCTGC233

Effect of different concentrations of β-hydroxybutyrate acid (BHBA) on the oxidase index of hepatocytes in vitro

SOD (U·mL−1)CAT (U·mL−1)MDA (mmol·mL−1)GSH-Px (U·mL−1)
0.07.43 ± 0.44a13.15 ± 0.48a11.94 ± 0.35b1.65 ± 0.05a
0.65.77 ± 0.69a12.44 ± 0.50a12.19 ± 0.32a1.52 ± 0.06a
1.24.02 ± 0.73b11.64 ± 0.72a12.86 ± 0.38a1.37 ± 0.08b
3.03.87 ± 0.84b9.15 ± 1.06b13.16 ± 0.38a1.39 ± 0.06b
Language: English
Page range: 313 - 324
Submitted on: Nov 1, 2023
|
Accepted on: Jun 17, 2024
|
Published on: Jun 22, 2024
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2024 Muhammad Ali Mohsin, Xiaojing Zhou, Yu Huiru, Wenxiang Shen, Baoxiang He, Przemysław Sobiech, Mariusz Pierzchała, Magdalena Ogłuszka, Rafał Starzyński, Garima Kalra, Bharti Deshmukh, Revathy Thangarasu, Neeraj Kashyap, Urszula Czarnik, Adam Lepczyński, Grzegorz Woźniakowski, Chandra S. Pareek, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.