Skip to main content
Have a personal or library account? Click to login
The small non-coding RNA rli106 contributes to the environmental adaptation and pathogenicity of Listeria monocytogenes Cover

The small non-coding RNA rli106 contributes to the environmental adaptation and pathogenicity of Listeria monocytogenes

Open Access
|Mar 2023

Figures & Tables

Table 1

Primers used in the study

Primer namePrimer sequences (5′→3′)Product size (bp)
rli106FGCCTCTTTGCAATCGAAA
rli106RACTACTATTACTTTAGACTAGTTTTCAATT225
P1GGTACC AAATAGCCGACTGCTCCAGC
P2AAATTCGTGTTATAATAAAATTGGTGAAATTAGATAAGTG351
P3CACTTATCTAATTTCACCAATTTTATTATAACACGAATTT
P4CTGCAG GATCTCTAGCATTGGAAAGCCA383
P5AAATAGCCGACTGCTCCAGC
P6GATCTCTAGCATTGGAAAGCCA722
P7CCGTGCTTGATTGCCGTTAC
P8AACTAGGCCGCCTGCACC1391/1166
CFAAGCTTGCCTCTTTGCAATCGAAA
CRCGGGATCCACTACTATTACTTTAGACTAG239
rli106F1GGATCCCAGTTGGCATATTAATATC
rli106R1CGGGGTACCGGTTAAGCGGTTTTGC271
DegUFCAAGCTTAAAAGAGAAATGTTTAATT
DegURGGTACCACTGTTTTTTCACTAATGA721
16S rRNAFGATGCATAGCCGACCTGAGA
16S rRNARTGCTCCGTCAGACTTTCGTC116
hemCFCGGATCCATGACGTTATCTAAAGGA
hemCRCCAAGCTTTTAAATTCGTTCTTCTACA1122
DegUF1GGATCCATGGCACTCAAAATCATGATTG
DegUF2CAAGCTTTTAGCGAATGTATACCCAGCC687

[i] F – forward; R – reverse

Fig. 1

Growth curves of LM strains under different environmental stresses. LM EGD-e – parental strain of Listeria monocytogenes; LM-△rli106rli106 deletion strain of Listeria monocytogenes; CLM-△rli106rli106 complementation strain of Listeria monocytogenes

A–F – Growth curves of LM EGD-e, LM-△rli106 and CLM-△rli106 under the conditions of 42°C, pH 9, 5% NaCl and 8% NaCl, 3.8% ethanol and 5 mM H2O2. Bars indicate the standard error of the mean

Fig. 2

Determination and comparisons of the motility of different strains of LM. LM EGD-e – parental strain of Listeria monocytogenes; LM-△rli106rli106 deletion strain of Listeria monocytogenes; CLM-△rli106rli106 complementation strain of Listeria monocytogenes

A – Kinetics of LM EGD-e (1), LM-△rli106 (2) and CLM-△rli106 (3) in semi-solid medium; B – Kinetics in tablets;

C – Diameter size of the bacterial colony on the plate; ns – not significant, P > 0.05. Bars indicate the standard error of the mean

Fig. 3

Effects of rli106 gene deletion on biofilm formation of LM

A – Formation of biofilm by the parental strain of Listeria monocytogenes (LM EGD-e), rli106 deletion strain of Listeria monocytogenes (LM-△rli106) and rli106 complementation strain of Listeria monocytogenes (CLM-△rli106) at 12 h, 24 h and 48 h; B – Comparison of biofilm formation at 12 h, 24 h and 48 h. Bars indicate the standard error of the mean (SE); ** – P < 0.01

Fig. 4

Determination of adhesion, invasion and intracellular viability in RAW264.7 macrophages for the parental strain of Listeria monocytogenes (LM EGD-e), rli106 deletion strain of Listeria monocytogenes (LM-△rli106) and rli106 complementation strain of Listeria monocytogenes (CLM-△rli106). A – Adhesion rate of LM EGD-e, LM-△rli106 and CLM-△rli106 in RAW264.7 cells; B – Invasion rate of LM EGD-e, LM-△rli106 and CLM-△rli106 in RAW264.7 cells; C – Determination of intracellular viability in macrophages. Bars indicate the standard error of the mean (SE); ** – P < 0.01

Fig. 5

Effects of rli106 gene deletion on virulence of LM. A – Survival curves of mice infected with the parental strain of Listeria monocytogenes (LM EGD-e), rli106 deletion strain of Listeria monocytogenes (LM-△rli106) and rli106 complementation strain of Listeria monocytogenes (CLM-△rli106); B and C – Bacterial loads in the livers and spleens of mice infected by LM EGD-e, LM-△rli106 and CLM-△rli106; bars indicate the standard error of the mean (SE); * – P < 0.05; ** – P < 0.01 (LM EGD-e)

Fig. 6

Histopathological examination of liver, spleen and kidney of mice infected by LM strains (haematoxylin and eosin staining, ×400). LM EGD-e – parental strain of Listeria monocytogenes rli106; LM-△rli106rli106 deletion strain of Listeria monocytogenes; CLM-△rli106rli106 complementation strain of Listeria monocytogenes

Fig. 7

Verification of interaction between rli106 sRNA and mRNA of target gene DegU. A – Complementary pairing position of DegU target gene and rli106; B and C – Bacterial lawns of BTH101 co-transformed by pUT18C and pMR-LacZ-DegU, and BTH101 co-transformed by pUT18C-rli106 and pMR-LacZ-DegU; D – OD420 nm of bacterial lawns; E – mRNA level of DegU target gene in the parental strain of Listeria monocytogenes (LM EGD-e), rli106 deletion strain of Listeria monocytogenes (LM-△rli106) and rli106 complementation strain of Listeria monocytogenes (CLM-△rli106); F and G – protein level of DegU in LM EGD-e, LM-△rli106 and CLM-△rli106

DOI: https://doi.org/10.2478/jvetres-2023-0013 | Journal eISSN: 2450-8608 (formerly 2300-3235)
Language: English
Page range: 67 - 77
Submitted on: Apr 1, 2022
Accepted on: Mar 3, 2023
Published on: Mar 17, 2023
Published by: National Veterinary Research Institute in Pulawy
In partnership with: Paradigm Publishing Services

© 2023 Yun Guo, Chunhui Ji, Lixia Wang, Chengcheng Ning, Na Li, Zhiyuan Li, Yunxia Shang, Yaling Li, Yaoqiang Sun, Xiaoxing Huang, Jie Li, Xuepeng Cai, Qingling Meng, Jun Qiao, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.