Have a personal or library account? Click to login
Establishment of a new canine inflammatory mammary carcinoma cell line and analysis of its cystine-glutamate transporter subunit expression Cover

Establishment of a new canine inflammatory mammary carcinoma cell line and analysis of its cystine-glutamate transporter subunit expression

Journal of Veterinary Research
Volume 66 (2022): Issue 2 (June 2022)
By: Harumichi Itoh,  Ryo Naruse,  Kenji Tani,  Hiroshi Sunahara,  Yuki Nemoto,  Munekazu Nakaichi,  Toshie Iseri,  Hiro Horikirizono and  Kazuhito Itamoto  
Open Access
|May 2022

Figures & Tables

Fig. 1

Histopathological examination and data analysis. A – infiltration of cancer cells into the lymphatic vessels (arrows); scale bar: 200 μm. B – immunostaining with cytokeratin 1/3 antibody showing cancer cells with infiltration into the lymphatic vessels to be of epithelial origin (arrows); scale bar: 200 μm. C – IMC-1 cells with epithelial characteristics as polygonal or circular shapes and arranged in a paving stone pattern without contact inhibition; scale bar: 100 μm. D – cell proliferation rate indicating 31 h doubling time. E and F – flow cytometric investigation of expression of CD24 and CD44 in IMC-1. Values represent the mean ± standard error (n = 6)
Histopathological examination and data analysis. A – infiltration of cancer cells into the lymphatic vessels (arrows); scale bar: 200 μm. B – immunostaining with cytokeratin 1/3 antibody showing cancer cells with infiltration into the lymphatic vessels to be of epithelial origin (arrows); scale bar: 200 μm. C – IMC-1 cells with epithelial characteristics as polygonal or circular shapes and arranged in a paving stone pattern without contact inhibition; scale bar: 100 μm. D – cell proliferation rate indicating 31 h doubling time. E and F – flow cytometric investigation of expression of CD24 and CD44 in IMC-1. Values represent the mean ± standard error (n = 6)

Fig. 2

Expression of xCT visualised by Western blot, flow cytometry and immunofluorescence. A – Western blot showing an xCT band in both IMC-1 cells and the positive controls (MDA-MB-231) and lower band intensity when IMC-1 cells were treated with SSZ at concentrations of 50 μM and 100 μM for 24 h. B – proportion of control and IMC-1 cells expressing xCT seen in flow cytometry. C – fluorescence microscopy of xCT expression by IMC-1 showing xCT throughout the cytoplasm to the cell surface. Values represent the mean ± standard error (n = 6). Scale bar: 100 μm
Expression of xCT visualised by Western blot, flow cytometry and immunofluorescence. A – Western blot showing an xCT band in both IMC-1 cells and the positive controls (MDA-MB-231) and lower band intensity when IMC-1 cells were treated with SSZ at concentrations of 50 μM and 100 μM for 24 h. B – proportion of control and IMC-1 cells expressing xCT seen in flow cytometry. C – fluorescence microscopy of xCT expression by IMC-1 showing xCT throughout the cytoplasm to the cell surface. Values represent the mean ± standard error (n = 6). Scale bar: 100 μm

Fig. 3

Expression levels of the NANOG, MYC, SOX2, and KLF4 CSC markers before and after SSZ treatment as determined by semi-quantitative PCR. A – bar charts showing significant differences in MYC, SOX2, and KLF4 expression between the SSZ-treated and the untreated cells. B – dot plot showing greater aldehyde dehydrogenase (ALDH) activity in experimental cells than in control cells but lower activity in SSZ-treated cells than in untreated cells. Red dotted area is calculated by control cells and represents cells with ALDH activity. C – bar chart showing a significant decrease in the number of positive cells after treatment with SSZ; ns – not significant; * p < 0.05. Values represent the mean ± standard error (n = 6).
Expression levels of the NANOG, MYC, SOX2, and KLF4 CSC markers before and after SSZ treatment as determined by semi-quantitative PCR. A – bar charts showing significant differences in MYC, SOX2, and KLF4 expression between the SSZ-treated and the untreated cells. B – dot plot showing greater aldehyde dehydrogenase (ALDH) activity in experimental cells than in control cells but lower activity in SSZ-treated cells than in untreated cells. Red dotted area is calculated by control cells and represents cells with ALDH activity. C – bar chart showing a significant decrease in the number of positive cells after treatment with SSZ; ns – not significant; * p < 0.05. Values represent the mean ± standard error (n = 6).

Primers used in this study

GeneForward primer (5′–3′)Reverse primer (5′–3′)
NANOGTGGAACAATCCGCTCCACAAGATGGACTCCAGATCACCCATAGAA
MYCGATCTCCTCCGGAGAGTGGAAACCACCGAGTCGTAGTCGAGGTCAT
SOX2GTGAGCGCCTGCAGTACAAGCGAGTAGGACATGCTGTAGGTG
KLF4GATGTGACCCACACTGCCAGATGTTGGGAACTTGACCATGATTGTA
HPRT1GGAGCATAATCCAAAGATGGTCAATCAGGTTTATAGCCAACACTTCGAG
DOI: https://doi.org/10.2478/jvetres-2022-0023 | Journal eISSN: 2450-8608
Journal RSS Feed
Language: English
Page range: 273 - 279
Submitted on: Mar 6, 2021
Accepted on: May 9, 2022
Published on: May 31, 2022
Published by: National Veterinary Research Institute in Pulawy
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year
Keywords:
inflammatory mammary carcinoma,
canine cell line,
xCT,
sulfasalazine,
aldehyde dehydrogenase activity
Related subjects:
Life sciences,
Molecular biology,
Microbiology and virology,
Life sciences, other,
Medicine,
Veterinary medicine

© 2022 Harumichi Itoh, Ryo Naruse, Kenji Tani, Hiroshi Sunahara, Yuki Nemoto, Munekazu Nakaichi, Toshie Iseri, Hiro Horikirizono, Kazuhito Itamoto, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Previous articleVolume 66 (2022): Issue 2 (June 2022)Next article