Fig. 1
Fig. 2
Fig. 3
Primer sequences used for detection of classical SE genes (sea–see) and the gene encoding toxic shock syndrome tsst-1
| Gene | Primer sequences | Product size (bp) | Reference |
|---|---|---|---|
| nuc | GCGATTGATGGTGATACGGTT | 279 | (12) |
| AGCCAAGCCTTGACGAACTAAAGC | |||
| sea | ACCGTTTCCAAAGGTACTGTA | 135 | (28) |
| TGGTACACCAAACAAAACAGC | |||
| seb | CCTAAACCAGATGAGTTGCAC | 592 | (28) |
| CAGGCATCATGTCATACCAAA | |||
| sec | AGATGAAGTAGTTGATGTGTATGG CTTCACACTTTTAGAATCAACCG | 454 | (20) |
| sed | GCTTGTACATATGGAGGTGTCA | 263 | (28) |
| GACCCATCAGAAGAATCAAACT | |||
| see | CAGTACCTATAGATAAAGTTAAAACAAGC | 178 | (10) |
| TAACTTACCGTGGACCCTTC | |||
| tsst-1 | GGCAGCATCAGCCTTATAATTT | 371 | (28) |
| GTGGATCCGTCATTCATTGTT |
Antibiotic resistance in S_ aureus strains isolated from samples of Thai fermented pork sausage, hospitalised patients, and healthy carriers
| Antibiotic group | Antibiotic | Antibiotic resistance in S. aureus isolates | ||
|---|---|---|---|---|
| Thai fermented pork sausages (n = 36) | Hospitalised patients (n = 54) | Healthy carriers (n = 10) | ||
| β-lactams | penicillin | 30 (83%) | 47 (87%) | 8 (80%) |
| ampicillin | 26 (72%) | 47 (87%) | 7 (70%) | |
| amoxicillin/clavulanic acid | 3 (8%) | 1 (2%) | 1 (10%) | |
| ceftriaxone | 0 (0%) | 0 (0%) | 0 (0%) | |
| cephazolin | 0 (0%) | 0 (0%) | 0 (0%) | |
| ceftazidime | 0 (0%) | 0 (0%) | 0 (0%) | |
| cefoxitin | 0 (0%) | 0 (0%) | 0 (0%) | |
| Lincosamides | clindamycin | 0 (0%) | 4 (7%) | 1 (10%) |
| Macrolides | erythromycin | 0 (0%) | 4 (7%) | 1 (10%) |
| Aminoglycosides | gentamicin | 0 (0%) | 0 (0%) | 0 (0%) |
| Phenicols | chloramphenicol | 0 (0%) | 2 (4%) | 0 (0%) |
| Glycopeptides | vancomycin | 0 (0%) | 0 (0%) | 0 (0%) |
| Sulphonamides | trimethoprim/sulfamethoxazole | 0 (0%) | 0 (0%) | 0 (0%) |
Detection of classical SE and tsst-1 genes by PCR and of classical SE production by RPLA
| S. aureus enterotoxin genotype | Thai fermented pork sausages (n = 36) | Hospitalised patients (n = 54) | Healthy carriers (n = 10) | |||
|---|---|---|---|---|---|---|
| PCR | RPLA | PCR | RPLA | PCR | RPLA | |
| sea | 17 (47%) | 22 (61%) – more frequent in Thai fermented pork sausages (P< 0.00001, compared to the hospitalised patient group) | 7 (13%) | 4 (7%) | 4 (40%) | 6 (60%) – more frequent in healthy carriers (P = 0.000189, compared to the hospitalised patient group) |
| seb | 4 (11%) | 15 (42%) | 18 (33%) | 15 (28%) | 1 (10%) | 3 (30%) |
| sec | 0 (0%) | 10 (28%) | 1 (2%) | 6 (11%) | 0 (0%) | 1 (10%) |
| sed | 0 (0%) | 0 (0%) | 0 (0%) | 0 (0%) | 0 (0%) | 0 (0%) |
| see | 1 (3%) | ND | 1 (2%) | ND | 0 (0%) | ND |
| tsst-1 | 0 (0%) | - | 0 (0%) | - | 0 (0%) | - |
| sea/seb | 2 (5%) | - | 1 (2%) | - | 1 (10%) | - |
| seb/sec | 6 (17%) | - | 9 (17%) | - | 0 (0%) | - |
| sea/seb/sec | 4 (11%) | - | 2 (4%) | - | 1 (10%) | - |
| seb/sec/tsst-1 | 0 (0%) | - | 4 (7%) | - | 0 (0%) | - |
| Total | 34 (94%) | 43 (80%) | 7 (70%) | |||
Grading of biofilm formation in S_ aureus strains isolated from three different sources
| OD ranges (570 nm) | Biofilm quantity grade | S. aureus isolates | ||
|---|---|---|---|---|
| Thai fermented pork sausages (n = 36) | Hospitalised patients (n = 54) | Healthy carriers (n = 10) | ||
| <0.19 | Biofilm non-former | 0 (0%) | 0 (0%) | 0 (0%) |
| ≥0.19 and ≤0.38 | Weak biofilm former | 0 (0%) | 0 (0%) | 0 (0%) |
| ≥0.38 and ≤0.76 | Moderate biofilm former | 2 (6%) | 0 (0%) | 0 (0%) |
| ≥0.76 | Strong biofilm former | 34 (94%) | 54 (100%) | 10 (100%) |