Have a personal or library account? Click to login
Characterisation of classical enterotoxins, virulence activity, and antibiotic susceptibility of Staphylococcus aureus isolated from Thai fermented pork sausages, clinical samples, and healthy carriers in northeastern Thailand Cover

Characterisation of classical enterotoxins, virulence activity, and antibiotic susceptibility of Staphylococcus aureus isolated from Thai fermented pork sausages, clinical samples, and healthy carriers in northeastern Thailand

Open Access
|May 2020

Figures & Tables

Fig. 1

PCR amplification of a S. aureus specific gene (nuc), classical SE genes (sea–see), and the tsst-1 gene. Lane M – 100 bp DNA marker; Lanes 1–7 – nuc, sea, seb, sec, sed, see, and tsst-1, respectively

Fig. 2

Production of extracellular enzymes (DNase, lipase, protease) and haemolysin by S. aureus strains isolated from three different sources. Data are presented as the mean diameter of clear zones surrounding colonies (mm), determined from triplicate independent experiments. * P < 0.05 is considered to be statistically significant in between-group comparisons

Fig. 3

Biofilm formation was evaluated by crystal violet staining in triplicate independent experiments. Absorbance at 570 nm was measured with a microplate reader. Isolates with OD570 values ≥0.76 were considered to be strong biofilm formers. * P < 0.05 was considered to be significantly different in between-group comparisons

Primer sequences used for detection of classical SE genes (sea–see) and the gene encoding toxic shock syndrome tsst-1

GenePrimer sequencesProduct size (bp)Reference
nucGCGATTGATGGTGATACGGTT279(12)
AGCCAAGCCTTGACGAACTAAAGC
seaACCGTTTCCAAAGGTACTGTA135(28)
TGGTACACCAAACAAAACAGC
sebCCTAAACCAGATGAGTTGCAC592(28)
CAGGCATCATGTCATACCAAA
secAGATGAAGTAGTTGATGTGTATGG CTTCACACTTTTAGAATCAACCG454(20)
sedGCTTGTACATATGGAGGTGTCA263(28)
GACCCATCAGAAGAATCAAACT
seeCAGTACCTATAGATAAAGTTAAAACAAGC178(10)
TAACTTACCGTGGACCCTTC
tsst-1GGCAGCATCAGCCTTATAATTT371(28)
GTGGATCCGTCATTCATTGTT

Antibiotic resistance in S_ aureus strains isolated from samples of Thai fermented pork sausage, hospitalised patients, and healthy carriers

Antibiotic groupAntibioticAntibiotic resistance in S. aureus isolates
Thai fermented pork sausages (n = 36)Hospitalised patients (n = 54)Healthy carriers (n = 10)
β-lactamspenicillin30 (83%)47 (87%)8 (80%)
ampicillin26 (72%)47 (87%)7 (70%)
amoxicillin/clavulanic acid3 (8%)1 (2%)1 (10%)
ceftriaxone0 (0%)0 (0%)0 (0%)
cephazolin0 (0%)0 (0%)0 (0%)
ceftazidime0 (0%)0 (0%)0 (0%)
cefoxitin0 (0%)0 (0%)0 (0%)
Lincosamidesclindamycin0 (0%)4 (7%)1 (10%)
Macrolideserythromycin0 (0%)4 (7%)1 (10%)
Aminoglycosidesgentamicin0 (0%)0 (0%)0 (0%)
Phenicolschloramphenicol0 (0%)2 (4%)0 (0%)
Glycopeptidesvancomycin0 (0%)0 (0%)0 (0%)
Sulphonamidestrimethoprim/sulfamethoxazole0 (0%)0 (0%)0 (0%)

Detection of classical SE and tsst-1 genes by PCR and of classical SE production by RPLA

S. aureus enterotoxin genotypeThai fermented pork sausages (n = 36)Hospitalised patients (n = 54)Healthy carriers (n = 10)
PCRRPLAPCRRPLAPCRRPLA
sea17 (47%)22 (61%)

– more frequent in Thai fermented pork sausages (P< 0.00001, compared to the hospitalised patient group)

7 (13%)4 (7%)4 (40%)6 (60%)

– more frequent in healthy carriers (P = 0.000189, compared to the hospitalised patient group)

seb4 (11%)15 (42%)18 (33%)15 (28%)1 (10%)3 (30%)
sec0 (0%)10 (28%)1 (2%)6 (11%)0 (0%)1 (10%)
sed0 (0%)0 (0%)0 (0%)0 (0%)0 (0%)0 (0%)
see1 (3%)ND1 (2%)ND0 (0%)ND
tsst-10 (0%)-0 (0%)-0 (0%)-
sea/seb2 (5%)-1 (2%)-1 (10%)-
seb/sec6 (17%)-9 (17%)-0 (0%)-
sea/seb/sec4 (11%)-2 (4%)-1 (10%)-
seb/sec/tsst-10 (0%)-4 (7%)-0 (0%)-
Total34 (94%)43 (80%)7 (70%)

Grading of biofilm formation in S_ aureus strains isolated from three different sources

OD ranges (570 nm)Biofilm quantity gradeS. aureus isolates
Thai fermented pork sausages (n = 36)Hospitalised patients (n = 54)Healthy carriers (n = 10)
<0.19Biofilm non-former0 (0%)0 (0%)0 (0%)
≥0.19 and ≤0.38Weak biofilm former0 (0%)0 (0%)0 (0%)
≥0.38 and ≤0.76Moderate biofilm former2 (6%)0 (0%)0 (0%)
≥0.76Strong biofilm former34 (94%)54 (100%)10 (100%)
Language: English
Page range: 289 - 297
Submitted on: Oct 25, 2019
|
Accepted on: May 13, 2020
|
Published on: May 27, 2020
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2020 Wanwisa Sankomkai, Wongwarut Boonyanugomol, Kairin Kraisriwattana, Julalak Nutchanon, Kraisorn Boonsam, Sasalux Kaewbutra, Warawan Wongboot, published by National Veterinary Research Institute in Pulawy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.