Introduction
Porcine circovirus (PCV) belongs to the Circoviridae family, Circovirus genus, and is one of the smallest animal viruses (19, 29). As a non-enveloped virus with single-stranded DNA (ssDNA), PCV can be divided into three types: PCV1, PCV2, and PCV3 (20). The last of them was identified in the United States in 2016 and described as an emerging virus there (21). Subsequently, PCV3 was detected in South America (Brazil) (25), Asia (China, Korea, Japan, and Thailand) (7, 8, 11, 12, 26) and Europe (Poland, Denmark, Italy, Spain, the UK, Germany, Russia, and Sweden) (1, 4, 23, 28, 29), causing widespread concern in the pig industry around the world (13, 22).
The existing studies show that the PCV3 genome is 2,000 bp in length, which is similar to the PCV1 and PCV2 genomes, and includes three open reading frames ORF1, ORF2, and ORF3 (19). ORF1 encodes a replication-associated protein, ORF2 encodes a capsid protein, and ORF3 encodes a protein unique to it. In recent years, studies of the molecular characteristics and pathogenicity of PCV3 have received increasing attention due to the widespread infection in pigs all over
the world (5, 13). It has been reported that PCV3 can infect a host alone or co-infect with other pathogens (32). Infection is documented as being associated with swine reproductive failure, fever, respiratory diseases, and multi-system inflammation. However, the pathogenesis of PCV3 and its role in co-infections remains unclear (5, 19, 31, 32). In addition, it has been noted that PCV3 infection can cause diseases such as congenital tremor and myocarditis in newborn piglets (4, 9, 17).
Xinjiang province, located in the northwest of China, covers an area of 1,665,900 km2 and is the most important animal husbandry region in China. In recent years, with the rapid development of the pig industry in Xinjiang, the number of live pigs has reached 4.1 million, and raising pigs has become an important means for farmers to increase their incomes. However, with the continuous intensification and expansion, reproductive disorders and infectious diseases of the respiratory and digestive tracts of pigs have also surged in prevalence, which has caused huge economic losses to the pig industry. As a newly discovered cross-border transmissible virus, the current infection status and molecular characteristics of PCV3 in Xinjiang are still unclear.
The purpose of the present study was to investigate the infection status and explore the molecular characteristics of Xinjiang strains of PCV3 in commercial pigs, which will provide useful molecular data for understanding the epidemic pattern of this infectious disease.
Material and Methods
Source and collection of samples. The clinical samples were collected in the two-year period 2017–2018 from animals from nine commercial pig farms in nine regions of Xinjiang province (Altai, Tacheng, Yili, Shihezi, Urumqi, Changji, Korla, Aksu, and Kashi) (Fig. 1A). A total of 393 samples were collected from pigs with clinical symptoms (fever, diarrhoea, and coughing), including 79 lymph nodes, 93 spleens, 62 lungs, 57 pleural effusions, and 102 serum samples (Table 3). These samples were sealed, placed in ice boxes, and transported at low temperature to the Xinjiang Key Laboratory of Animal Disease Prevention and Control.

Fig. 1
A – geographic distribution of sampled farms, B – positive rates of PCV3 infection in different commercial pig farms in Xinjiang province, China
Note: Positive rate was determined based on PCR analysis of clinical samples.
Primer design and synthesis. A pair of primers were designed and synthesised according to the PCV3 sequence (KX778720.1) deposited in GenBank (http://www.ncbi.nlm.nih.gov/genbank/) The FP1–RP1 primer was used for PCR detection of the positive samples, and the FP2–RP2 primer was used for the full-length PCR of cap from the PCV3 Xinjiang epidemic strain (Table 2). The primers were synthesised by Sangon Biotech Co., Ltd (Shanghai, China).
Table 1
GenBank accession numbers of PCV3 strains
| Strain | Accession number |
|---|---|
| 2164 | KX458235 |
| PCV3-US/MN2016 | KX898030 |
| PCV3-US/SD2016 | KX966193 |
| PCV3/CN/Fujian-5/2016 | KY075986 |
| PCV3/CN/Henan-13/2016 | KY075988 |
| PCV3/CN/Jiangxi-62/2016 | KY075989 |
| PCV3/CN/Chongqing-150/2016 | KY075992 |
| CN/Hubei-618/2016 | KY354039 |
| CCV-A | KY363870 |
| CCV-B | KY363871 |
| CCV-C | KY363872 |
| PCV3-China/GD2016 | KY418606 |
| PCV3/KU-1601 | KY996337 |
| PCV3/KU-1604 | KY996340 |
| PCV3/KU-1606 | KY996342 |
| PCV3/KU-1608 | KY996344 |
| PCV3/KU-1609 | KY996345 |
| P1705SCYC/2017 | MF063070 |
| 16R927/2016 | MF063071 |
| PCV3-BR/RS/6 | MF079253 |
| PCV3/CN/Jiangxi-B1/2017 | MF589107 |
| PCV3/CN/Jiangxi-S1/2017 | MF589133 |
| PCV3/CN/Guangdong-CH/2016 | MF589112 |
| PCV3/CN/Guangdong-X1/2016 | MF589118 |
| 309 | MF589652 |
| JX-1/CH/2017 | MF677838 |
| 1621_Italy_2017 | MF805719 |
| 4332-5_Denmark_2017 | MF805723 |
| 4332-7_Denmark_2017 | MF805724 |
| DE2.8 | MG014377 |
| DE19.15 | MG014367 |
| DE27.16 | MG014370 |
| PCV3/HU/Szerencs/2017 | MG595741 |
| PCV3-RU/TY17 | MG679916 |
| PCV3-JSXY-201701 | MG868940 |
| PCV3-HBWH-201703 | MG868941 |
| PCV3-SH-201705 | MG868945 |
| SD | MG947596 |
| PCV3-CN2018HLG-5 | MH277111 |
| PCV3-CN2018JL-1 | MH277112 |
| PCV3-CN2018LN-3 | MH277117 |
| COL/Cundinamarca2/2018 | MH327785 |
| CN/Xinjiang-AK16/2018 | MK562412 |
| CN/Xinjiang-AL5/2018 | MK562413 |
| CN/Xinjiang-CH29/2018 | MK562414 |
| CN/Xinjiang-KA2/2018 | MK562415 |
| CN/Xinjiang-KO17/2018 | MK562416 |
| CN/Xinjiang-SH6/2018 | MK562417 |
| CN/Xinjiang-TA36/2018 | MK562418 |
| CN/Xinjiang-UR22/2018 | MK562419 |
| CN/Xinjiang-YI7/2018 | MK562420 |
| 29160 | NC031753 |
Table 2
List of primer sequences used in this study
| Primer name | Nucleotide sequence | Position in reference | Product size |
|---|---|---|---|
| (5′→ 3′) | sequence | (bp) | |
| FP1 | CCGTAGAAGTCTGTCATTCCAG | 1383–1404 | |
| RP1 | AAGCCCTGGCACGCCAACCAC | 1796–1816 | 434 |
| FP2 | TTAGAGAACGGACTTGTAACGA | 1343–1364 | |
| RP2 | ATGAGACACAGAGCTATATTCAG | 1965–1987 | 645 |
Table 3
Detection of PCV3 infection in different samples from commercial pig farms in Xinjiang province, China
| Clinical samples | Number of samples | Number of positive samples | Positive rate (%) of PCV3 |
|---|---|---|---|
| Lymph nodes | 79 | 29 | 36.71 (29/79) a |
| Spleen | 93 | 22 | 23.66 (22/93) a |
| Lung | 62 | 9 | 14.52 (9/62) b |
| Pleural effusion | 57 | 13 | 22.81 (13/57) a |
| Serum | 102 | 15 | 14.71 (15/102) b |
| Total | 393 | 88 | 22.39 (88/393) |
[i] Note: Different superscript letters (a, b) in one column means significant difference (P < 0.05)
DNA isolation of collected samples. Briefly, the samples were placed in a grinder and milled with 1.5 mL of sterile physiological saline. The milled solution was collected in a 2.0 mL EP tube and frozen and thawed three times. Samples were centrifuged at 12,000 rpm for 5 min, and then the supernatant was collected for DNA extraction using a MiniBEST Viral RNA/DNA Extraction Kit (TaKaRa Bio, Shiga, Japan) according to the manufacturer’s instructions. The extracted DNA was used as the template for PCR detection.
PCR detection. PCR detection of nucleic acids in positive samples was performed using FP1–RP1 primers. The PCR reaction mix included: 21 μL of water, 1 μL (0.2 μmol/L) of each FP1–RP1 primer, 25 μL of 2× Premix Ex Taq (TaKaRa Bio), and 2 μL of DNA template. Reaction conditions were as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 20 s, annealing at 60°C for 30 s and extension at 72°C for 30 s for 35 cycles, and final extension at 72°C for 10 min. PCR products were detected by 1.5% agarose gel electrophoresis after amplification and the detection results were statistically analysed.
Amplification, cloning, and sequencing of the full length Cap gene from the PCV3 Xinjiang strain.
A randomly chosen sample that showed positive PCR results was selected from each Xinjiang provincial region, and PCR amplification of the PCV3 full-length cap gene was performed using FP2–RP2 primers. The PCR reaction system was the same as mentioned above. Reaction conditions were as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 20 s, annealing at 60°C for 30 s and extension at 72°C for 50 s for 30 cycles, and extension at 72°C for 10 min. Then the PCR product was detected by 1.5% agarose gel electrophoresis. It was recovered by a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany), and the recovered fragment was cloned into a pMD18-T vector (TaKaRa Bio). The positive clone was subsequently screened by PCR and sent for sequencing by Sangon Biotech Co., Ltd. Three positive clones for each sample were selected and each clone was sequenced three times. The sequence of positive clones from identical sequencing results was used for alignment analysis.
Phylogenetic analysis of Cap gene in PCV3 Xinjiang epidemic strains. The nine DNA sequences of cap genes from PCV3 Xinjiang epidemic strains and 43 domestic and foreign strains (Supplementary Table 2) of different regions were compared by DNAstar 7.1 (DNASTAR Inc., USA) and Clustal X 2.1 (http://www.clustal.org/) software, and the homology and the genetic variation characteristics of cap gene in PCV3 Xinjiang epidemic strains were analysed. A cap gene phylogenetic tree from PCV3 epidemic strains was constructed and the genetic evolution relationship between different strains was analysed by Mega software version 7.0 (https://www.megasoftware.net/)
Statistical analysis. Statistical analysis was conducted using SAS software (Version 9.1, SAS Institute, Inc., Cary, NC, USA). The detection rates on different commercial pig farms in Xinjiang Province were compared using a chi-squared (x2) test. The value of P < 0.05 was considered statistically significant, while P < 0.01 was considered an extremely significant difference.
Results
PCV3-specific nucleic acids were detected in samples from nine commercial pig farms in Xinjiang province (Fig. 1B, Supplementary Fig.1). The prevalence of PCV3 in pig farms was 100.0% (12/12), while in all the tested samples it was 22.39% (88/393). The detection rate of PCV3 in different commercial pig farms ranged from 15.79% to 28.30% (Supplementary Table 1). By sample type 14.52–36.71% of tested material was positive. Among them, the detection rate was the highest in lymph nodes (36.71%, 29/79), which was significantly different from lung and serum samples (P < 0.05) (Table 3). The PCR results indicated that PCV3 infection was common in the commercial pig farms of Xinjiang.
The cap gene was amplified from all nine PCR-positive samples in fragments all of 645 bp, which was consistent with the expected size (Supplementary Fig. 2). The cap genes from nine PCV3 Xinjiang epidemic strains (named CN/Xinjiang-SH6/2018, CN/Xinjiang-TA36/2018, CN/Xinjiang-AL5/2018, CN/Xinjiang-UR22/2018, CN/Xinjiang-AK16/2018, CN/Xinjiang-YI7/2018, CN/Xinjiang-KO17/2018, CN/Xinjiang-CH29/2018, and CN/Xinjiang-KA2/2018) were submitted to GenBank (accession numbers MK562412– MK562420). The cap genes of Xinjiang strains shared 98.9–99.3% identity and the nucleotide sequences shared 97.5–100.0% identity with other strains of PCV3 from domestic and foreign farms (Supplementary Table 3).

Fig. 2
Phylogenetic analysis of PCV3 strains based on the full-length cap gene using the neighbour-joining method
Note: The nucleotide sequences of cap gene of PCV3 strains obtained in this study and available in GenBank were used to construct a phylogenetic tree by the neighbour-joining method. Bootstrap values were calculated with 1,000 replicates. Vertical lines are used to indicate groups (or subgroups) which were referred to in the text. Filled circles indicate the PCV3 strains identified in this study
Among 52 epidemic strains of PCV3 from different regions of the world (Supplementary Table 2), 73 nucleotide variation sites in the cap gene were identified, which caused 18 mutation sites in the amino acid sequence of the cap protein. In the nine PCV3 Xinjiang strains, there were 31 nucleotide variation sites in the cap gene (Supplementary Fig. 3), leading to the mutation of amino acids at positions 20, 24, 75, 77, 108, 111 and 206 of the cap protein.
Phylogenetic analysis based on the cap gene showed that PCV3 strains can be divided into two genetic groups. Group 1 can be divided into subgroups 1.1 and 1.2, and Group 2 can likewise be divided into subgroups 2.1 and 2.2 (Fig. 2). The nine Xinjiang strains resolved to all four subgroups: four belonged to subgroup 1.1, one to subgroup 1.2, two to subgroup 2.1, and two to subgroup 2.2 (Table 4), showing obvious genetic diversity.
Table 4
Genetic diversity of PCV3 strains circulating in commercial pig farms in Xinjiang province, China
| PCV3 strains | Group | Subgroup |
|---|---|---|
| CN/Xinjiang-SH6/2018 | 1 | 1.1 |
| CN/Xinjiang-TA36/2018 | 1 | 1.1 |
| CN/Xinjiang-AL5/2018 | 1 | 1.2 |
| CN/Xinjiang-UR22/2018 | 1 | 1.1 |
| CN/Xinjiang-YI7/2018 | 2 | 2.1 |
| CN/Xinjiang-CH29/2018 | 2 | 2.2 |
| CN/Xinjiang-AK16/2018 | 2 | 2.1 |
| CN/Xinjiang-KO17/2018 | 2 | 2.2 |
| CN/Xinjiang-KA2/2018 | 1 | 1.1 |
The GenBank accession numbers of 52 strains PCV3 are given in Table 1.
Discussion
PCV2 is still one of the most important viruses threatening the pig industry (11, 20). Due to the widespread use of commercial vaccines in Chinese pig herds, PCV2 infection has been controlled to some extent (31). However, since PCV3 was first discovered in 2016, PCV3 infection has occurred on pig farms in more than 10 provinces including Jiangxi, Hubei, Henan, Chongqing, Fujian, Guangdong, Hunan, and Jiangsu, causing great damage to the Chinese pig industry (3, 16, 18, 19, 24, 27). Some studies showed that PCV3 infection was associated with abortion, respiratory failure, and diarrhoea in weaned piglets (10, 31); however, the pathogenesis of PCV3 was still unclear (5, 13). Therefore, it was urgent and necessary to carry out studies on the mechanisms of PCV3 infection, pathogenesis, and immunity (14, 15, 17).
The intensive pig farming system may contribute to the rapid spread of various infectious pathogens. In addition, the global trade in breeding pigs, semen, and pork also has important impact on the global spread of PCV (2, 22, 24). In this study, we examined samples from animals with clinical lesions in Xinjiang province, China. It was shown that PCV3 infection had occurred in pig populations, which may be related to the introduction of a large number of breeding pigs into Xinjiang from foreign countries and domestic provinces in recent years. Among the tested samples, PCV3 could be detected from lymph nodes, spleens, lungs, pleural effusion, and serum, the lymph nodes yielding very high detectable content. Assessment of the risk of PCV3 transmission and exploration of its role in cases of unknown aetiologies is an exigent need. It was reported that PCV3 could also infect pigs without any clinical lesions, and latent infection should consequently be further investigated in pigs without any clinical lesions.
The genetic and traceability analyses of PCV3 epidemic strains are of great significance for preventing and controlling this infectious disease (17, 18, 22). In this study, the nucleotide sequences of the cap gene from nine strains of PCV3 in Xinjiang shared high identities with other strains from China and abroad. However, it is worth noting that compared with the PCV3 29160 reference strain, there were only scattered point mutations in the amino acid sequence of cap protein and no base insertion or deletion sites. Considering the fact that cap protein is the only structural protein and main antigen of PCV3 (3, 19), it is still unclear whether the variation in these amino acid positions could cause the changes in its virulence and immunogenicity (33). Phylogenetic tree analysis based on the cap gene showed that PCV3 can be divided into two gene groups, which is consistent with the findings of Fux et al. (6). Notably, the nine PCV3 Xinjiang epidemic strains in this study belonged to different subgroups of two gene groups, displaying obvious genetic diversity. However, the intrinsic relationship between the genetic diversity of PCV3 and its biological properties such as virulence and immunogenicity requires further study, which may provide important information for the development of an effective vaccine to control PCV3 infection in the pig industry.
In summary, the present study demonstrated for the first time that PCV3 infection was common in commercial pig herds and had significant genetic diversity. Therefore, biosecurity should be a strengthened component in pig farm anti-epidemic measures, and disinfection regulations should be strictly enforced. Furthermore, breeding pigs should be quarantined before introduction to prevent PCV3 from spreading through long-distance cross-border transportation.
Notes
[2] Conflicts of interest Conflict of Interest
Conflict of Interests Statement: The authors declare that there is no conflict of interests regarding the publication of this article.
[3] Financial disclosure Financial Disclosure Statement: This research was supported by the National Key Research and Development Program (No. 2017FD502300), Young and Middle-aged Leading Science and Technology Innovation Talents Plan of Xinjiang Corps (No. 2016BC001), and the Cooperation Project of Urumqi-Chongqinq in Science and Technology (No. Y161220001).
Acknowledgments
We thank the field staff who provided the samples for this study.
Supplementary Figs 1–3 and Tables 1–3 comprise separate pdf files viewable online at http://content.sciendo.com/view/journals/jvetres/jvetres-overview.xml and doi: 10.2478/jvetres-2019-0071