Molecular and morphological characterization of Avenae-group cyst nematodes (Heteroderidae) from Greece

Journal of Nematology

Volume 57 (2025): Issue 1 (February 2025)

By:

Andrea M. Skantar, Zafar A. Handoo, Maria N. Hult, Alemayehu Habteweld, Maria Kormpi and Emannuel A. Tzortzakakis

Open Access

|Mar 2025

Figures & Tables

Photomicrographs of J2 showing lip region (top row) and tail regions (bottom) of Heterodera species (Avenae group) from Greece. (A, B) H. filipjevi; (C, D) H. hordecalis; (E, F) H. mani. Scale bar: 10 μm.

Photomicrographs of vulva cones of cyst showing vulva fenestra (all bifenstrate), vulva slit, bullae, and underbridge of Heterodera species, Avenae group. Heterodera filipjevi: (A) vulval slit (arrow) and underbridge; (B) Bullae (arrow); H. hordecalis: (C) vulval slit (arrow) and strong underbridge with bifurcate ends (arrow); (D) Bullae absent; H. mani: (E) vulval slit (arrow) and underbridge; (F) bullae (arrow). Images were captured at different focal planes to emphasize diagnostic features. Scale bars, A, B, D, 10μm; C, E, F, 20 μm.

Statistical parsimony network showing phylogenetic relationships among ITS rRNA haplotypes of H. filipjevi populations. Circle size is proportional to the number of sequences with each haplotype. New sequences are in bold. Numbers on branches indicate bp differences between haplotypes.

Statistical parsimony network showing phylogenetic relationships among mtCOI haplotypes of H. filipjevi populations. Circle size is proportional to the number of sequences with each haplotype. New sequences are in bold. Numbers on branches indicate bp differences between haplotypes. The sequence MG523083* in haplotype HfA10 was determined to have originated from the Livadia, Greece population but was mistakenly attributed to Crete.

Statistical parsimony network showing phylogenetic relationships among ITS rRNA haplotypes of H. hordecalis populations. Circle size is proportional to the number of sequences with each haplotype. New sequences in bold.

Statistical parsimony network showing phylogenetic relationships among mtCOI haplotypes of H. hordecalis populations.

Statistical parsimony network showing phylogenetic relationships among ITS rRNA haplotypes of H. mani populations. Circle size is proportional to the number of sequences with each haplotype. New sequences in bold.

Phylogenetic relationships of Heterodera Avenae group species from Greece inferred from partial Hsp90 genomic DNA sequence alignments analyzed by Bayesian Inference. Posterior probabilities are shown on appropriate branches. New sequences in bold.

Molecular similarity of 28S, ITS, mtCOI, and Hsp90 sequences obtained from Greek isolates of Avenae group species relative to existing sequences in GenBank_ Intraspecific variation refers to differences among sequences recovered from each new population_

Marker	Species name	*Heterodera filipjevi*	*Heterodera filipjevi*	*Heterodera filipjevi*	*Heterodera filipjevi*	*Heterodera hordecalis*	*Heterodera mani*

	Source	Potato field	Potato field	Turfgrass	Wheat	Potato field	Garlic field
	Location, year	Viotia Greece, M1 2013	Livadia Greece, B12 2015	Athens, Greece 2021	Oregon, USA 2008	Laconia, Greece M2, 2013	Thiva, Greece 2021
28S	Population Code	86G	96E	115H	35A	86H	116A
	intraspecific variation^*	0 bp	0 bp	0 bp	0 bp	0 bp	0 bp
	closest GenBank hit	GU083592	MG859980	MG859980	GU083592	LT159829	OQ918098
		H. filipjevi	H. filipjevi	H. filipjevi	H. filipjevi	H. hordecalis	H. mani
ITS	coverage	100%	100%	100%	99%	100%	98%
	% identity	100%	100%	100%	99.7%	100%	100%
	intraspecific variation^*	0 bp	0–4 bp	1–6 bp	0 bp	0–1 bp	7–10 bp
	closest GenBank hit	MT254744	MT254744	MT254744	MT254744	MK840642	MG523157
		H. filipjevi	H. filipjevi	H. filipjevi	H. filipjevi	H. hordecalis	H. mani
COI	coverage	100%	100%	98%	100%	100%	100%
	% identity	100%	99.8%	99.9%	100%	99.0%	99.8%
	intraspecific variation^*	0 bp	0 bp	0 bp	1 bp	2 bp	0 bp
	closest GenBank hit	MG523083	MK093059	MK093059	MK093059	MG5232140	MG523097
		H. filipjevi	H. filipjevi	H. filipjevi	H. filipjevi	H. hordecalis	H. mani
Hsp90	coverage	90%	96%	84%	97%	88%	99%
	% identity	99.5%	98.3%	99.0%	99.8%	91.48%	100%
	intraspecific variation^*	3–64 bp	0–16	n/d	12–24 bp	4–9 bp	0–11 bp
	closest GenBank hit	MH848608	MH848608		MH848608	JQ316192	MH484608
		H. avenae	H. avenae		H. avenae	H. avenae	H. avenae
	coverage	93%	93%		92%	99%	99%
	% identity	87.4%	87.8%		86.9%	82.9%	92.6%

Main morphometric characters of J2 from Avenae-group of Heterodera species recovered during present study from Greece including H_ filipjevi, H_ hordecalis, and H_ mani_ All measurements except lateral lines are in micrometers (µm) and in the form of mean (range)_

Morphometric characters	*H. filipjevi*	*H. hordecalis*	*H. mani*
Body length	552 (462–662)	464 (417–525)	552 (526–578)
Stylet	25 (23–26)	24 (23–26)	25 (24–26)
Tail	61 (53–68)	57 (48–63)	65 (61–67)
Hyaline tail	41 (33–50)	36 (31–41)	41 (39–42)
Lateral lines	4	4	4

GenBank accession numbers of DNA markers from Avenae-group species including H_ filipjevi H_ hordecalis and H_ mani generated for this study_

Species name	Code	Host	Location, year	GenBank accession numbers

				28S	ITS	mtCOI	Hsp90
Heterodera filipjevi	86G	Potato field	Viotia Greece, M1, 2013	PQ098459-PQ098461	PQ096808-PQ096810	PQ096970, PQ096971	PQ143935-PQ143941
	96E	Potato field	Livadia Greece, B12, 2015	PQ098464-PQ098467	PQ096802-PQ096804	PQ096975, PQ096976	PQ143942-PQ143945
	115H	Turfgrass	Athens, 2021	PQ098468-PQ098470	PQ096811-PQ096814	PQ096972-PQ096974
	35A	Wheat	Oregon, USA, 2008	PQ098456-PQ098458	PQ096805-PQ096807	PQ096969, PQ096977	PQ143930-PQ143934
Heterodera hordecalis	86H1	Potato field	Laconia, Greece, M2, 2013	PQ098462-PQ098463	PQ096819-PQ096821	PQ096964-PQ096965	PQ143946-PQ143950
Heterodera mani	116A	Garlic field	Thiva, Greece, 2021	PQ098471-PQ098472	PQ096815-PQ096818	PQ096966-PQ096968	PQ143951-PQ143956

Primers used for PCR amplification of DNA markers from Heterodera spp_

Marker	Primers	Sequence 5′→3′	Primer and PCR References
28S	D2Ab	ACAAGTACCGTGAGGGAAAGTTG	De Ley et al., 2005
28S	D3B	TCGGAAGGAACCAGCTACTA	Ye et al., 2007
ITS	TW81	GTTTCCGTAGGTGAACCTGC	Joyce et al., 1994
ITS	AB28	ATATGCTTAAGTTCAGCGGGT	Skantar et al., 2012
mtCOI	Het-cox-1F	TAGTTGATCGTAATTTTAATGG	Subbotin, 2015
mtCOI	Het-cox-1R	CCTAAAACATAATGAAAATGWGC
Hsp90	U288	GAYACVGGVATYGGNATGACYAA	Skantar and Carta, 2005
Hsp90	L1110	TCRCARTTVTCCATGATRAAVAC

DOI: https://doi.org/10.2478/jofnem-2025-0008 | Journal eISSN: 2640-396X | Journal ISSN: 0022-300X

Journal RSS Feed

Language: English

Submitted on: Sep 23, 2024

Published on: Mar 19, 2025

Published by: Society of Nematologists, Inc.

In partnership with: Paradigm Publishing Services

Publication frequency: 1 times per year

Keywords:

Hsp90,

mtCOI,

Related subjects:

© 2025 Andrea M. Skantar, Zafar A. Handoo, Maria N. Hult, Alemayehu Habteweld, Maria Kormpi, Emannuel A. Tzortzakakis, published by Society of Nematologists, Inc.
This work is licensed under the Creative Commons Attribution 4.0 License.

Previous article Volume 57 (2025): Issue 1 (February 2025)Next article

Molecular and morphological characterization of Avenae-group cyst nematodes (Heteroderidae) from Greece

Figures & Tables

Figure 1:

Figure 2:

Figure 3:

Figure 4:

Figure 5:

Figure 6:

Figure 7:

Figure 8:

Molecular similarity of 28S, ITS, mtCOI, and Hsp90 sequences obtained from Greek isolates of Avenae group species relative to existing sequences in GenBank_ Intraspecific variation refers to differences among sequences recovered from each new population_

Main morphometric characters of J2 from Avenae-group of Heterodera species recovered during present study from Greece including H_ filipjevi, H_ hordecalis, and H_ mani_ All measurements except lateral lines are in micrometers (µm) and in the form of mean (range)_

GenBank accession numbers of DNA markers from Avenae-group species including H_ filipjevi H_ hordecalis and H_ mani generated for this study_

Primers used for PCR amplification of DNA markers from Heterodera spp_

Paradigm

My account