Table 1:
Main morphometric characters of J2 from Avenae-group of Heterodera species recovered during present study from Greece including H. filipjevi, H. hordecalis, and H. mani. All measurements except lateral lines are in micrometers (µm) and in the form of mean (range).
| Morphometric characters | H. filipjevi | H. hordecalis | H. mani |
|---|---|---|---|
| Body length | 552 (462–662) | 464 (417–525) | 552 (526–578) |
| Stylet | 25 (23–26) | 24 (23–26) | 25 (24–26) |
| Tail | 61 (53–68) | 57 (48–63) | 65 (61–67) |
| Hyaline tail | 41 (33–50) | 36 (31–41) | 41 (39–42) |
| Lateral lines | 4 | 4 | 4 |
Table 2:
Primers used for PCR amplification of DNA markers from Heterodera spp.
| Marker | Primers | Sequence 5′→3′ | Primer and PCR References |
|---|---|---|---|
| 28S | D2Ab | ACAAGTACCGTGAGGGAAAGTTG | De Ley et al., 2005 |
| D3B | TCGGAAGGAACCAGCTACTA | Ye et al., 2007 | |
| ITS | TW81 | GTTTCCGTAGGTGAACCTGC | Joyce et al., 1994 |
| AB28 | ATATGCTTAAGTTCAGCGGGT | Skantar et al., 2012 | |
| mtCOI | Het-cox-1F | TAGTTGATCGTAATTTTAATGG | Subbotin, 2015 |
| Het-cox-1R | CCTAAAACATAATGAAAATGWGC | ||
| Hsp90 | U288 | GAYACVGGVATYGGNATGACYAA | Skantar and Carta, 2005 |
| L1110 | TCRCARTTVTCCATGATRAAVAC |
Table 3:
GenBank accession numbers of DNA markers from Avenae-group species including H. filipjevi H. hordecalis and H. mani generated for this study.
| Species name | Code | Host | Location, year | GenBank accession numbers | |||
|---|---|---|---|---|---|---|---|
| 28S | ITS | mtCOI | Hsp90 | ||||
| Heterodera filipjevi | 86G | Potato field | Viotia Greece, M1, 2013 | PQ098459-PQ098461 | PQ096808-PQ096810 | PQ096970, PQ096971 | PQ143935-PQ143941 |
| 96E | Potato field | Livadia Greece, B12, 2015 | PQ098464-PQ098467 | PQ096802-PQ096804 | PQ096975, PQ096976 | PQ143942-PQ143945 | |
| 115H | Turfgrass | Athens, 2021 | PQ098468-PQ098470 | PQ096811-PQ096814 | PQ096972-PQ096974 | ||
| 35A | Wheat | Oregon, USA, 2008 | PQ098456-PQ098458 | PQ096805-PQ096807 | PQ096969, PQ096977 | PQ143930-PQ143934 | |
| Heterodera hordecalis | 86H1 | Potato field | Laconia, Greece, M2, 2013 | PQ098462-PQ098463 | PQ096819-PQ096821 | PQ096964-PQ096965 | PQ143946-PQ143950 |
| Heterodera mani | 116A | Garlic field | Thiva, Greece, 2021 | PQ098471-PQ098472 | PQ096815-PQ096818 | PQ096966-PQ096968 | PQ143951-PQ143956 |
Figure 1:
Photomicrographs of J2 showing lip region (top row) and tail regions (bottom) of Heterodera species (Avenae group) from Greece. (A, B) H. filipjevi; (C, D) H. hordecalis; (E, F) H. mani. Scale bar: 10 μm.
Figure 2:
Photomicrographs of vulva cones of cyst showing vulva fenestra (all bifenstrate), vulva slit, bullae, and underbridge of Heterodera species, Avenae group. Heterodera filipjevi: (A) vulval slit (arrow) and underbridge; (B) Bullae (arrow); H. hordecalis: (C) vulval slit (arrow) and strong underbridge with bifurcate ends (arrow); (D) Bullae absent; H. mani: (E) vulval slit (arrow) and underbridge; (F) bullae (arrow). Images were captured at different focal planes to emphasize diagnostic features. Scale bars, A, B, D, 10μm; C, E, F, 20 μm.
Table 4:
Molecular similarity of 28S, ITS, mtCOI, and Hsp90 sequences obtained from Greek isolates of Avenae group species relative to existing sequences in GenBank. Intraspecific variation refers to differences among sequences recovered from each new population.
| Marker | Species name | Heterodera filipjevi | Heterodera filipjevi | Heterodera filipjevi | Heterodera filipjevi | Heterodera hordecalis | Heterodera mani |
|---|---|---|---|---|---|---|---|
| Source | Potato field | Potato field | Turfgrass | Wheat | Potato field | Garlic field | |
| Location, year | Viotia Greece, M1 2013 | Livadia Greece, B12 2015 | Athens, Greece 2021 | Oregon, USA 2008 | Laconia, Greece M2, 2013 | Thiva, Greece 2021 | |
| 28S | Population Code | 86G | 96E | 115H | 35A | 86H | 116A |
| intraspecific variation* | 0 bp | 0 bp | 0 bp | 0 bp | 0 bp | 0 bp | |
| closest GenBank hit | GU083592 | MG859980 | MG859980 | GU083592 | LT159829 | OQ918098 | |
| H. filipjevi | H. filipjevi | H. filipjevi | H. filipjevi | H. hordecalis | H. mani | ||
| ITS | coverage | 100% | 100% | 100% | 99% | 100% | 98% |
| % identity | 100% | 100% | 100% | 99.7% | 100% | 100% | |
| intraspecific variation* | 0 bp | 0–4 bp | 1–6 bp | 0 bp | 0–1 bp | 7–10 bp | |
| closest GenBank hit | MT254744 | MT254744 | MT254744 | MT254744 | MK840642 | MG523157 | |
| H. filipjevi | H. filipjevi | H. filipjevi | H. filipjevi | H. hordecalis | H. mani | ||
| COI | coverage | 100% | 100% | 98% | 100% | 100% | 100% |
| % identity | 100% | 99.8% | 99.9% | 100% | 99.0% | 99.8% | |
| intraspecific variation* | 0 bp | 0 bp | 0 bp | 1 bp | 2 bp | 0 bp | |
| closest GenBank hit | MG523083 | MK093059 | MK093059 | MK093059 | MG5232140 | MG523097 | |
| H. filipjevi | H. filipjevi | H. filipjevi | H. filipjevi | H. hordecalis | H. mani | ||
| Hsp90 | coverage | 90% | 96% | 84% | 97% | 88% | 99% |
| % identity | 99.5% | 98.3% | 99.0% | 99.8% | 91.48% | 100% | |
| intraspecific variation* | 3–64 bp | 0–16 | n/d | 12–24 bp | 4–9 bp | 0–11 bp | |
| closest GenBank hit | MH848608 | MH848608 | MH848608 | JQ316192 | MH484608 | ||
| H. avenae | H. avenae | H. avenae | H. avenae | H. avenae | |||
| coverage | 93% | 93% | 92% | 99% | 99% | ||
| % identity | 87.4% | 87.8% | 86.9% | 82.9% | 92.6% |
Figure 3:
Statistical parsimony network showing phylogenetic relationships among ITS rRNA haplotypes of H. filipjevi populations. Circle size is proportional to the number of sequences with each haplotype. New sequences are in bold. Numbers on branches indicate bp differences between haplotypes.
Figure 4:
Statistical parsimony network showing phylogenetic relationships among mtCOI haplotypes of H. filipjevi populations. Circle size is proportional to the number of sequences with each haplotype. New sequences are in bold. Numbers on branches indicate bp differences between haplotypes. The sequence MG523083* in haplotype HfA10 was determined to have originated from the Livadia, Greece population but was mistakenly attributed to Crete.
Figure 5:
Statistical parsimony network showing phylogenetic relationships among ITS rRNA haplotypes of H. hordecalis populations. Circle size is proportional to the number of sequences with each haplotype. New sequences in bold.
Figure 6:
Statistical parsimony network showing phylogenetic relationships among mtCOI haplotypes of H. hordecalis populations.
Figure 7:
Statistical parsimony network showing phylogenetic relationships among ITS rRNA haplotypes of H. mani populations. Circle size is proportional to the number of sequences with each haplotype. New sequences in bold.
Figure 8:
Phylogenetic relationships of Heterodera Avenae group species from Greece inferred from partial Hsp90 genomic DNA sequence alignments analyzed by Bayesian Inference. Posterior probabilities are shown on appropriate branches. New sequences in bold.