Morphological Characterization and Assessment of Genetic Variability of Tylenchulus semipenetrans Populations from Southern Iran

The sampling sites of Tylenchulus semipenetrans the corresponding GenBank accession numbers for ITS, D2-D3 expansion segments of 28S and COI mtDNA sequences obtained in this study.

Soil sample codes	GPS location		Locality	*Host (Citrus* spp.)**	rDNA genes		Mt DNA COI
Soil sample codes	latitude	longitude	Locality	*Host (Citrus* spp.)**	D2–D3	ITS	Mt DNA COI
25	28.6694	53.60647	Qotb Abad, Jahrom	C. limetta	OP723626	OP722727	OP739535
32	28.52135	53.67221	Jahrom	C. sinensis	OP723604	OP722708	OP739514
42	29.57487	51.73012	Ahmad Abad, Kazerun	C. sinensis	OP723627	OP722728	OP739536
112	28.95546	53.60143	Phase-e5, Fasa	C. sinensis	OP723629	OP722729	OP739537
411	29.62299	51.58779	Hasan Abad, Kazerun	C. sinensis	OP723616	OP722718	OP739524
678	28.99909	53.12713	Aliabad, Khafr	C. aurantium	OP723630	OP722730	-
682	28.98881	53.15637	Balashahr, Khafr	C. sinensis	-	-	-
698	28.51967	53.60683	Heydarabad, Jahrom	C. limetta	OP723597	-	OP739507
707	28.53547	53.65353	Najib Abad, Jahrom	C. aurantium	OP723610	OP722704	OP739510
710	28.5391	53.53022	Maghsudabad, Jahrom	C. limetta	OP723606	OP722696	OP739515
712	28.5397	53.53049	Maghsudabad, Jahrom	C. aurantium	OP723631	OP722731	OP739538
716	28.47551	53.49098	Mill, Jahrom	C. aurantium	OP723607	OP722710	OP739516
717	28.66863	53.60608	Qotb Abad, Jahrom	C. limetta	OP723591	OP722698	OP739501
720	28.66878	53.6059	Yousofabad, Jahrom	C. limetta	OP723592	OP722699	OP739502
733	28.93138	53.60712	Kazemabad, Fasa	C. sinensis	OP723601	OP722705	OP739511
735	28.97311	53.63675	Banyan, Fasa	C. sinensis	OP723613	OP722715	OP739521
737	28.95768	53.5981	Phase-e5, Fasa	C. sinensis	OP723614	OP722716	OP739522
743	29.03657	53.64304	Akbarabad, Fasa	C. bigaradia	OP723615	OP722717	OP739523
746	28.668855	54.665161	Bagh-e Morakabat, Darab	C. sinensis	OP723628	OP722722	OP739529
749	28.72201	54.57227	Naghsh Shapour, Darab	C. sinensis	OP723632	OP722732	OP739539
755	28.67927	54.65618	Jannat Shahr, Darab	C. bigaradia	OP723639	OP722738	OP739546
759	28.64105	54.64284	Deh Kheyr Payin, Darab	C. sinensis	OP723633	OP722733	OP739540
763	28.75331	54.44562	Sharak-e Sarollah, Darab	C. sinensis	OP723618	OP722719	OP739526
765	28.95749	53.60026	Hasan Abad, Darab	C. limetta	OP723634	-	OP739541
771	28.786689	54.339938	Fasarood, Darab	C. aurantium	OP723593	OP722700	OP739503
772	28.687654	54.647131	Zein Abad Sangi, Darab	C. sinensis	OP723608	OP722712	OP739517
773	28.76994	54.22515	Eij, Darab	C. sinensis	OP723602	OP722706	OP739512
777	28.445396	53.042906	Gandoman, Karzin	C. reticulata	OP723594	OP722701	OP739504
780	28.442301	53.143399	Emam Shahr, Ghir	C. limetta	OP723596	OP722702	OP739506
785	28.34352	53.25282	Tang-e Ruein, Ghir	C. aurantium	OP723636	OP722735	OP739543
789	28.452529	53.127036	Deh Beh, Ghir	C. aurantium	OP723609	OP722711	OP739518
793	28.285395	53.074062	Mand, Karzin	C. bigaradia	OP723619	OP722720	OP739527
795	28.328269	53.038029	Eslam Abad, Karzin	C. aurantium	OP723620	OP722721	OP739528
801	29.56717	51.75703	Ahmadabad, Kazerun	C. aurantium	OP723611	OP722713	OP739519
802	29.56924	51.75969	Ahmadabad, Kazerun	C. aurantium	OP723637	OP722736	OP739544
812	29.79435	51.57338	Ganjeii, Kazerun	C. sinensis	OP723640	OP722739	OP739547
818	29.7594	51.55155	Sheykhi, Kazerun	C. sinensis	OP723642	OP722741	OP739549
821	29.72973	51.53522	Anarestan, Kazerun	C. sinensis	OP723612	OP722714	OP739520
882	29.56109	51.77738	Zavali, Kazerun	C. aurantium	OP723638	OP722737	OP739545
908	29.00358	53.11102	Karadeh, Khafr	C. aurantium	OP723603	OP722707	OP739513
921	28.92434	53.33666	Khavaran, Khafr	C. sinensis	OP723641	OP722740	OP739548
740-2	28.89014	53.68479	Dastjeh, Fasa	C. sinensis	OP723617	-	OP739525
Ami	28.96260	54.04458	Darab	C. aurantium	OP723621	OP722723	OP739530
ARE	29.61910	52.57446	Sardaran, Shiraz	C. limetta	OP723635	OP722734	OP739542
Beh	28.47110	53.03187	Karzin	C. aurantium	OP723622	OP722724	OP739531
Behz-Greenhouse	29.63544	52.52485	Eram Garden, Shiraz	C. aurantium	OP723623	OP722725	OP739532
Sh1	36.613791	53.258824	Behshahr1, Mazandaran	C. sinensis	OP723624	-	OP739533
Sh2	36.625476	52.931576	Behshahr2, Mazandaran	C. sinensis	OP723625	OP722726	OP739534

Principal Component Analysis (PCA) performed on populations of *Tylenchulus semipenetrans* collected from citrus orchards in Fars province, focusing on the morphometric characteristics of the second-stage juveniles (A) and males (B).

Table 2:

The primers used in this study for identification and genetic diversity of Tylenchulus semipenetrans populations.

Primer code	Primer sequence (5′-3′)	Product size (bp)	Target region	References
18S	TTGATTAGGTCCCTGCCCTTT	967	ITS1-5.8S-ITS2	Marek et al., 2010
21S	TTTCACTCGCCGTTACTAAGG	967	ITS1-5.8S-ITS2	Marek et al., 2010
TW81F	GTTTCCGTAGGTGAACCTGC	809–841	ITS1-5.8S-ITS2	Tanha Maafi et al., 2003
AB28R	ATATGCTTAAGTTCAGCGGGT	809–841	ITS1-5.8S-ITS2	Tanha Maafi et al., 2003
Ts2-IF	TTCGAGAAACTTGGGGATTGGC	770	ITS1-5.8S-ITS2	Present study
Ts2-IR	CAGGGACCTATGATCAAGTGCT	770	T. semipenetrans specific	Present study
D2AF	ACAAGTACCGTGAGGGAAAGTTG	774–777	28S D2-D3	Subbotin et al., 2006
D3BR	TCGGAAGGAACCAGCTACTA	774–777	28S D2-D3	Subbotin et al., 2006
COI-F5	AATWTWGGTGTTGGAACTTCTTGAAC	790	Cytochrome oxidase subunit I	Powers et al., 2014
COI-R9	CTTAAAACATAATGRAAATGWGCWACW
COI-R9	ACATAATAAGTATC-

Table 3:

Summary information of single nucleotide variations (SNV) and/or single nucleotide polymorphism (SNPs) analysis in this study for identification and genetic diversity of Tylenchulus semipenetrans populations from Fars province, Iran.

Locus	No. of sites	Segregating sites or SNVs	SNPs	No. of haplotypes	Nucleotide diversity	Tajima’s D	Sequence conservation	Min recombination
COI	603	16	11	10	Pi: 0.00767	D: 0.89661	C: 0.973	1
D2D3	676	24	12	33	Pi: 0.00535	D: −1.02740	C: 0.964	6
ITS	597	17	11	16	Pi: 0.00515	D: −0.89706	C: 0.972	2

Table 4:

Morphometrics of males of 30 populations (five specimens each) of Tylenchulus semipenetrans, collected from citrus orchards of Fars Province, Iran. Data are given as mean ± standard deviation (range) of population means or specimens. Measurements are in μm.

Characters	Means of populations	Specimens
n	30	143
L	346 ± 13.2 (318.3–375)	347 ± 21 (296–424)
a	34.9 ± 1.9 (31.7–39.7)	34.9 ± 2.8 (29.6–44.9)
b	3.4 ± 0.2 (3.1–3.8)	3.5 ± 0.2 (2.8–4.3)
c	9.7 ± 0.5 (8.5–10.8)	9.7 ± 0.7 (8.0–12.1)
c’	4.7 ± 0.3 (4.1–5.5)	4.7 ± 0.5 (3.5–6.1)
Stylet	8.4 ± 0.4 (7.7–9.2)	8.4 ± 0.6 (7–11.1)^a
Conus	4.9 ± 0.3 (4.3–5.7)	4.9 ± 0.5 (3.5–6.4)
Anterior end to the center of the median bulb	43.7 ± 3.2 (34.2–50)	43.7 ± 4.6 (31–64)
Pharynx length	100 ± 4.8 (90–111)	101 ± 7.6 (83–123)
Anterior end to hemizonid	65.6 ± 2.8 (58.6–70.6)	65.6 ± 4.1 (52–77)
Anterior end to nerve ring	61.1 ± 3.0 (53.0–66.7)	61.1 ± 4.2 (48.5–72.5)
Secretory-excretory pore (S. E. pore) to cloaca	100 ± 6.1 (87–110)	101 ± 8.9 (75–119.5)
Anterior end to S. E. pore	231 ± 20.7 (198–279)	229 ± 44 (161–333)
S. E. pore from the anterior end (% of L)	66.9 ± 5.3 (58.0–78.)	66 ± 12 (54–91.2)
Median bulb width	4.5 ± 0.6 (3.2–5.6)	4.5 ± 0.7 (2.7–6.2)
Median bulb length	11.2 ± 0.9 (9.3–13.0)	11.2 ± 1.4 (7.1–14)
Median bulb length/diam. Ratio	252 ± 30.3 (199–328)	251 ± 41 (176–385)
Max. body width (BW)	10.0 ± 0.5 (9.1–11.0)	10.0 ± 0.8 (8.3–13)
BW in Pharynx	8.8 ± 0.4 (8.0–9.6)	8.8 ± 0.6 (7.3–10.7)
Anal BW	7.7 ± 0.5 (7.3–10.2)	7.7 ± 0.9 (6.7–16.4)
Spicules (curved median line)	16.6 ± 0.7 (15.5–17.8)	16.6 ± 1.1 (14–20)
Gubernaculum	3.7 ± 0.3 (3.1–4.3)	3.7 ± 0.5 (2.5–5.0)
Tail	36.0 ± 2.4 (33.1–42.0)	36 ± 3.4 (29–47.5)
M	0.6 ± 0.0 (0.5–0.6)	60 ± 6 (41–77)
Stylet / L (%)	2.4 ± 0.1 (2.2–2.6)	2.4 ± 0.2 (2.1–3.2)
S. E. pore / L (%)	66.9 ± 5.3 (58.0–78.7)	66 ± 12 (53.9–91.2)

a: Stylet was greater than 10 μm in only four specimens

Table 5:

Morphometrics of the second-stage juveniles of 31 populations (five specimens each) of Tylenchulus semipenetrans, collected from citrus orchards of Fars Province, Iran. Data are expressed as mean ± standard deviation (range) of population means or specimens. Measurements are in μm.

Character/Population code	Means of populations	Specimens
n	31	154
L	331 ± 12.1 (304–349)	332 ± 18 (276–376)
a	27.6 ± 1.1 (24.3–29.7)	28 ± 2 (22.4–34.7)
b	3.5 ± 0.1 (3.2–3.7)	3.5 ± .2 (3.1–4.1)
Stylet	11.4 ± 0.3 (11–11.8)	11.4 ± .4 (10.4–12.4)
Conus	6.1 ± 0.2 (5.5–6.7)	6.1 ± .4 (4.8–7.3)
Anterior end to the center of the median bulb	46.7 ± 1.6 (43.4–49.5)	46.8 ± 2.4 (39.9–53)
Pharynx length	94 ± 3.7 (85–103)	95 ± 5 (76–106.5)
MB	49.3 ± 1.2 (45.5–51)	49 ± 2 (41–55)
Anterior end to hemizonid	66.1 ± 2.2 (61.3–70.4)	66 ± 3.4 (58–77)
Anterior end to secretory-excretory pore (S. E. pore)	183 ± 7.5 (168–196)	183 ± 12 (147–222)
Anterior end to nerve ring	61.1 ± 2.3 (57.1–66.6)	61 ± 3 (51–71)
S. E. pore to genital primordium (GP)	19.4 ± 2.8 (12.8–24.9)	20 ± 4.2 (12–32)
Anterior end to GP	200 ± 6.7 (184–212)	200 ± 10 (165–222)
GP length	12.6 ± 1.6 (9.8–17.4)	13 ± 2 (8.5–21)
GP to the posterior end	118 ± 7.4 (101–130)	119 ± 11.7 (90–155)
Excretory pore from the anterior end (% of L)	56.2 ± 2.1 (53.2–60.4)	56 ± 3 (47–64)
Anterior end to GB (% of L)	60.6 ± 1.3 (58.4–63.2)	60 ± 2 (54–67)
Median bulb width	6.2 ± 0.3 (5.4–6.6)	6 ± .5 (4.9–7.5)
Median bulb length	13.2 ± 0.9 (11.9–16)	13 ± 1.4 (10–18)
Median bulb length/diam. ratio	211 ± 16.5 (182–262)	212 ± 26 (104–282)
body width (BW) in Pharynx	11.2 ± 0.4 (10.3–11.9)	11 ± .6 (9.6–13)
Max. BW	12.0 ± 0.4 (10.7–12.6)	12 ± .6 (10–14)
M	0.5 ± 0.02 (0.5–0.6)	.5 ± 0 (.4–.7)
Stylet / L (%)	3.5 ± 0.1 (3.2–3.9)	3.4 ± .2 (3–4)
S. E. pore / L (%)	55.4 ± 2.1 (51.8–60)	55 ± 3 (47–64)

Table 6:

Single nucleotide polymorphism in the alignment of the citrus nematode (Tylenchulus semipenetrans) ITS of rDNA gene partial sequences.

32	37	46	71	92	122	139	151	159	161	162	188	225	354	405	423	523
T. semipenetrans JN112270.1	CD1_cl2	A	G	G	T	C	A	G	C	A	C	T	T	C	T	C	C	C
TsA (n = 20)	37, 42, 112, 678, 706, 716, 717, 733, 743, 755, 763, 777, 778, 789, 795, 821,882, 921 BEHZ & SH2	A	G	G	T	C	A	G	C	A	C	T	T	C	T	C	C	C
TsB (n = 6)	707, 710, 754, 801, 818 & ARE	C	A	G	A	C	A	G	C	A	C	T	T	C	T	C	C	C
TsC (n = 1)	812	C	A	G	T	C	A	G	C	A	C	C	T	C	T	C	C	C
TsD (n = 3)	720, 773 & 802	C	A	A	A	C	A	C	C	A	C	T	T	C	T	C	C	C
TsE (n = 1)	785	C	A	G	A	C	A	A	C	A	C	T	C	T	T	C	C	C
TsF (n = 1)	759	C	A	G	A	T	A	A	C	A	C	T	C	C	T	C	C	C
TsG (n = 6)	712, 735, 737, 749, 771, & 908	A	G	G	T	C	A	G	C	A	C	C	T	C	T	C	C	C
TsH (n = 1)	25	C	A	G	A	T	A	A	C	A	T	T	C	C	T	C	C	C
TsI (n = 1)	BEH	A	G	G	T	C	A	G	C	A	C	T	T	T	T	C	C	C
TsJ (n = 1)	AMI	A	G	G	T	C	A	G	C	A	C	T	C	C	T	C	C	C
TsK (n = 1)	746	C	A	G	A	T	A	A	C	A	C	T	C	C	A	T	C	T
TsL (n = 1)	793	C	A	G	A	C	A	G	C	G	C	T	T	C	T	C	C	C
TsM (n = 1)	411	C	A	G	T	T	A	A	C	A	C	T	C	C	T	C	C	C
TsN (n = 1)	772	C	A	G	T	C	A	G	T	T	C	T	T	C	T	C	T	T
TsO (n = 1)	32	C	A	G	A	T	G	A	C	A	C	T	C	C	T	C	C	C
TsP (n = 1)	780	C	G	G	T	C	A	G	C	A	C	C	T	C	T	C	C	C

Bayesian phylogenetic tree of *Tylenchulus semipenetrans* isolates from citrus orchards in Fars province based on the ITS of rDNA sequences, analyzed under the General Time Reversible with a gamma distribution (GTR + G) model. Numbers at nodes are posterior probability values. Sequences with codes in the parentheses generated in this study. The codes in parentheses indicate the haplotype of the relevant population.

Table 7:

Single nucleotide polymorphism in the alignment of the citrus nematode (Tylenchulus semipenetrans) D2-D3 of 28 S rDNA gene.

34	55	59	73	84	94	104	113	119	125	157	167	223	238	260	263	340	355	369	456	497	502	616	661
T. semipenetrans KM598334.1	ES-Jirof2	G	C	T	C	C	T	A	G	G	A	C	G	T	T	C	C	G	C	G	A	C	T	G	A
Ts1 (n = 6)	720, 773, 32, 759, 765 & 818	G	C	T	C	C	T	A	G	G	A	C	G	T	T	C	C	G	C	G	A	C	T	G	A
Ts2 (n = 2)	BEH & 921	G	C	T	C	T	T	A	G	G	A	C	C	T	T	C	C	T	C	G	A	T	T	G	A
Ts3 (n = 2)	AMI & 812	G	C	T	C	T	T	A	G	G	A	C	C	T	T	C	C	T	C	G	A	C	T	G	A
Ts4 (n = 1)	755	G	C	T	C	C	T	A	G	G	A	C	G	G	C	C	C	G	C	G	G	C	T	G	A
Ts5 (n = 1)	882	G	C	T	C	C	T	A	G	G	A	C	G	T	C	C	C	G	C	G	G	C	T	A	A
Ts6 (n = 1)	802	G	C	T	C	T	T	A	G	G	A	C	G	T	T	C	C	T	C	T	A	C	T	G	A
Ts7 (n = 1)	785	G	C	T	C	C	T	A	A	G	A	C	G	T	T	C	C	G	C	G	A	C	T	G	A
Ts8 (n = 1)	ARE	G	C	T	C	T	T	A	G	G	A	C	C	T	T	C	C	T	T	G	A	T	T	G	A
Ts9 (n = 2)	740 & 749	G	C	T	C	C	T	A	G	G	G	C	G	T	T	C	C	G	C	G	A	C	T	G	A
Ts10 (n = 1)	712	G	C	T	C	C	T	A	G	G	G	T	G	T	T	C	C	G	C	G	A	C	T	G	A
Ts11 (n = 1)	678	G	C	T	C	T	T	A	G	G	A	C	G	T	C	C	C	G	C	G	A	C	T	G	A
Ts12 (n = 2)	112 & 777	G	C	T	C	T	T	A	G	G	A	C	C	T	T	C	T	T	C	G	A	T	T	G	A
Ts13 (n = 1)	746	G	C	T	C	C	T	T	G	G	G	T	G	T	T	C	C	G	C	G	A	C	T	G	A
Ts14 (n = 1)	42	G	C	T	C	T	T	A	G	G	A	C	G	T	T	C	C	T	C	G	A	C	T	G	A
Ts15 (n = 1)	25	G	C	T	C	C	T	A	G	T	G	C	G	T	T	C	C	G	C	G	A	C	T	G	A
Ts16 (n = 9)	717, 698, 706, 716, 789, 821, 743, 763 & SH2	G	C	T	C	C	T	A	G	G	A	C	G	T	C	C	C	G	C	G	G	C	T	G	A
Ts17 (n = 2)	733 & SH1	G	C	T	C	C	T	A	G	G	A	C	G	T	C	C		G	C	G	A	C	T	G	A
Ts18 (n = 1)	BEHZ	G	C	T	C	C	T	A	G	G	A	C	C	T	T	C	C	T	C	G	A	C	T	G	A
Ts19 (n = 1)	795	G	C	T	C	T	T	A	G	G	A	C	G	T	C	C	C	T	C	G	A	C	T	G	A
Ts20 (n = 2)	754 & 793	G	C	T	C	C	T	A	G	G	G	T	G	T	T	T	C	G	C	G	A	C	T	G	A
Ts21 (n = 1)	411	G	C	T	C	C	T	A	G	G	A	C	G	T	T	C	C	G	C	G	A	C	C	G	A
Ts22 (n = 1)	737	G	C	T	C	T	T	A	G	G	A	C	G	T	T	C	C	G	C	G	A	C	T	G	A
Ts23 (n = 1)	735	G	C	T	C	T	T	A	G	G	G	T	G	T	T	C	C	T	C	G	A	C	T	G	A
Ts24 (n = 1)	801	G	C	T	C	T	T	A	G	G	A	C	C	T	T	C	C	T	C	T	A	T	T	G	A
Ts25 (n = 1)	707	G	C	T	C	T	T	A	G	G	A	C	G	T	C	C	C	G	C	T	A	C	T	G	A
Ts26 (n = 1)	772	T	C	C	G	T	T	A	G	G	A	C	G	T	T	C	C	T	C	G	A	C	T	G	A
Ts27 (n = 1)	710	G	C	T	C	T	T	A	G	G	A	C	C	T	T	C	C	G	C	G	A	C	T	G	A
Ts28 (n = 1)	37	G	T	C	C	C	T	A	G	G	A	C	G	T	T	C	C	G	C	G	A	C	T	G	A
Ts29 (n = 1)	908	G	C	T	C	C	C	A	G	G	G	C	G	T	T	C	C	G	C	G	A	C	T	G	A
Ts30 (n = 1)	788	G	C	T	C	T	T	A	G	G	A	C	G	T	C	C	C	G	C	G	G	C	T	G	A
Ts31 (n = 1)	780	G	C	T	C	C	T	A	G	G	G	T	G	T	T	C	C	G	C	T	A	C	T	G	A
Ts32 (n = 1)	778	G	C	T	C	T	T	A	G	G	A	C	C	T	C	C	C	G	C	G	A	C	T	G	A
Ts33 (n = 1)	771	G	C	T	C	C	T	A	G	G	G	T	G	T	T	C	C	G	C	G	A	C	T	G	C

Bayesian phylogenetic tree of *Tylenchulus semipenetrans* isolates from citrus orchards in Fars province based on D2-D3 28S rDNA partial sequences, analyzed by the General Time Reversible (GTR) model. The numbers shown at the nodes are posterior probability values. Sequences with codes in the parentheses generated in this study. The codes in parentheses indicate the haplotype of the relevant population.

Table 8:

Single nucleotide polymorphism (SNPs) in the alignment of the citrus nematode (Tylenchulus semipenetrans) COI mtDNA partial gene.

49	250	353	385	393	406	425	448	469	481	515	532	535	562	574	580
TsI (n = 21)	771, 908, 32, 710, 801, 735, 737, 793, 795, 746, AMI, BEHZ, 25, 42, 112, 749, 759, ARE, 802, 25 & 812	C	G	A	T	A	A	T	A	T	A	A	G	A	C	A	T
TsII (n = 10)	698, 754, 707, 733, 716, 763, BEH, 712, 765 & 921	T	A	A	C	A	A	T	A	A	A	A	A	A	C	A	T
TsIII (n = 11)	720, 772, 773, 821, 743, 411, SH1, SH2, 785, 755 & 818	T	A	A	T	A	A	T	T	A	G	A	A	G	T	G	T
TsIV (n = 1)	740-2	T	A	A	C	A	A	T	T	A	G	A	A	G	T	G	T
TsV (n = 1)	789	T	A	A	C	A	A	T	A	A	A	A	A	A	T	G	T
TsVI (n = 1)	706	C	G	A	T	A	A	T	A	T	A	G	G	A	C	A	T
TsVII (n = 1)	780	C	G	A	T	C	G	T	A	T	A	A	G	A	C	A	T
TsVIII (n = 1)	778	C	G	C	T	A	A	T	A	T	A	G	G	A	C	A	T
TsIX (n = 1)	777	C	G	A	T	A	A	T	A	T	A	A	G	A	C	A	G
TsX (n = 1)	717	C	G	A	T	A	A	G	A	T	A	A	G	A	C	A	T

Bayesian phylogenetic tree of *Tylenchulus semipenetrans* isolates from citrus orchards of the Fars Province based on COI mtDNA partial sequences, analyzed under the General Time Reversible (GTR) Model. Numbers shown on nodes are posterior probability values. All *T. semipenetrans* sequences were produced in this study. The codes in parentheses indicate the haplotype of the relevant population.

A: principal component analysis (PCA) generalized linear modeling of *Tylenchulus semipenetrans* haplotypes from citrus orchards of the Fars province based on COI mtDNA, and B: the corresponding phylogenetic tree, analyzed under the Hasegawa Kishino Yano (HKY) model in MEGA 7. Numbers shown on nodes are posterior probability values.

Agarose gel electrophoresis verification of amplified products of ITS rDNA reactions using forward Ts2-IF and reverse Ts2-IR. The lane labeled as follows: Negative control (N), *T. semipenetrans* (1–3), *Tylenchorhynchus* sp. (4 & 5), *Mesocriconema* sp. (6 & 7), *Hemicycliophora* sp. (8 & 9), and DNA ladder (L).

Ethidium bromide-stained gels containing reaction products of ITS rDNA region of *T. semipenetrans* following PCR amplification with A) the primers forward 18S and reverse 21S and B) the newly designed primer set: forward Ts2-IF and reverse Ts2-IR. The amplification product of the 18S and 21S primer sets was more than 1000 bp, and these primers inefficiently amplified the target region from most of the isolates, whereas the new primer set properly amplified a smaller region of the ITS gene from all isolates of the citrus nematode.

Alignment results of ITS rDNA gene sequences, at the area of designed primers of common plant-parasitic nematode taxa in citrus orchards, using Mega 7. A) Forward primer search B) Reverse primer search.

Haplotype genealogy graph for COI (A) and ITS (B) sequences based on TCS network analysis. Each circle represents a haplotype.

References

Authors

Metrics

Articles in this issue

DOI: https://doi.org/10.2478/jofnem-2024-0047 | Journal eISSN: 2640-396X | Journal ISSN: 0022-300X

Journal RSS Feed

Language: English

Submitted on: Jul 29, 2024

Published on: Dec 15, 2024

Published by: Society of Nematologists, Inc.

In partnership with: Paradigm Publishing Services

Publication frequency: 1 issue per year

Keywords:

COI,

Related subjects:

© 2024 Mohammad Rumiani, Miloslav Zouhar, Akbar Karegar, Habiballah Hamzehzarghani, Ahmad Tahmasebi, Milad Rashidifard, published by Society of Nematologists, Inc.
This work is licensed under the Creative Commons Attribution 4.0 License.

Volume 56 (2024): Issue 1 (March 2024)

Morphological Characterization and Assessment of Genetic Variability of Tylenchulus semipenetrans Populations from Southern Iran

Figures & Tables

Figure 1:

Table 1:

Figure 2:

Table 2:

Table 3:

Table 4:

Table 5:

Table 6:

Figure 3:

Table 7:

Figure 4:

Table 8:

Figure 5:

Figure 6:

Figure 7:

Supplementary Figure 1:

Supplementary Figure 2:

Supplementary Figure 3:

Paradigm

My account