Table 1.
Information of geographical distribution areas of Meloidogyne arenaria in two pistachio-growing provinces of Iran and newly generated sequences in present study.
| Population code | Sampling area | N | E | LSU D2-D3 GenBank accession No. | COII-16S GenBank accession No. | Nad5 GenBank accession No. |
|---|---|---|---|---|---|---|
| KN1-1 | Kerman province, Nough | 30′58′24.0″ | 55′35′35.8″ | - | OR268637 | OR264475 |
| KR1-1 | Kerman province, Rafsanjan | 30′25′17.0″ | 55′49′40.9″ | - | OR268638 | OR264476 |
| KhF1-2 | Khorasan Razavi province, Feyzabad | 34′58′36.8″ | 58′42′09.8″ | OR267403 | OR268639 | - |
| KhF1-3 | Khorasan Razavi province, Feyzabad | 34′57′14.0″ | 58′39′28.1″ | OR267404 | OR268640 | OR264477 |
Table 2.
List of primers used for sequencing of different loci in the present study.
| Locus | Primers | 5′ to 3′ Sequence | Reference |
|---|---|---|---|
| LSU rDNA D2-D3 | D2Ab | ACAAGTACCGTGAGGGAAAGTTG | De Ley et al. (1999) |
| D3B | TCGGAAGGAACCAGCTACTA | ||
| COII-16S | C2F3 | GGTCAATGTTCAGAAATTTGTGG | Powers and Harris (1993) |
| 1108 | TACCTTTGACCAATCACGCT | ||
| NADH dehydrogenase subunit 5 (Nad5) | NAD5F | TATTTTTTGTTTGAGATATATTAG | Janssen et al. (2016) |
| NAD5R | CGTGAATCTTGATTTTCCATTTTT |

Figure 1:
Photographs of root galls caused by Meloidogyne arenaria on pistachio in Kerman and Khorasan Razavi provinces, Iran. A: Irregular galls by isolate KR1-1; B: Irregular galls by KN1-1 isolate; C: Irregular galls by KhF1-2 isolate; D: Spheroid galls by KhF1-3 isolate. (All scale bars = 10 mm).

Figure 2:
Light microphotographs of stylet and cephalic region of Iranian population of M. arenaria (isolate KhF1-2). A: Stylet, B: Anterior body region, C: The excretory pore. (All scale bars = 10 μm).

Figure 3:
Light microphotographs of perineal patterns of studied M. arenaria populations. A, B: Isolate KR1-1; C, D: Isolate KN1-1; E, F: Isolate KhF1-2; G, H: Isolate KhF1-3; A, C, E, G: The dorsal arch is high; B, D, F, H: The dorsal arch is moderately high, phasmids are distinct. (All scale bars = 10 μm).
Table 3.
Morphometricsa of females of four Meloidogyne arenaria populations from pistachio gardens in Iran compared with other populations. Measurements in μm.
| This study | Previous studies | |||||
|---|---|---|---|---|---|---|
| Character | KR1-1 | KN1-1 | KhF1-2 | KhF1-3 | Total | |
| n | 7 | 7 | 7 | 7 | 28 | |
| Body length | 804.3±62.9 (720–890) | 849.3±46.0 (770–900) | 862.9±24.3 (840–900) | 875±44.3 (810–940) | 847.9±51.6 (720–940) | 741±115b (601–985) |
| Body width | 542.9±46.8 (480–590) | 628.6±27.3 (590–670) | 578.6±27.9 (550–620) | 649.3±31.7 (590–685) | 599.8±53.4 (480–685) | 448±89b (334–626) |
| Stylet | 16.6±0.6 (15.5–17.0) | 17.1±0.2 (17.0–17.5) | 16.6±0.5 (16–17) | 17.4±0.6 (17.0–18.5) | 16.9±0.6 (15.5–18.5) | 15.1±0.05c (13–17) n=150 |
| DGO | 4.1±0.4 (3.5–4.5) | 5.4±0.7 (4–6) | 4.4±0.5 (4–5) | 4.9±0.4 (4.5–5.5) | 4.7±0.7 (3.5–6) | 4.8±0.06c (3.1–6.6) n=150 |
| Excretory pore to anterior end | 41.0±5.4 (35–49) | 41.9±4.0 (39–50) | 36.3±3.9 (31–42) | 30.4±3.0 (25–34) | 37.4±6.1 (25–50) | 42.2±0.94c (18–80) n=150 |
| Vulval slit | 23.1±1.6 (21–25) | 27.9±2.6 (25–33) | 21.2±1.8 (19–24) | 25.4±1.1 (24–27) | 24.4±3.1 (19–33) | 29.3±4.1 (24–37) n=9b |
| Vulva-anus | 16.6±1.4 (15–19) | 19.6±1.2 (18–21) | 19.1±2.0 (16.5–22.0) | 20.4±0.9 (19.0–21.5) | 18.9±1.9 (15–22) | 20.7±2.6 (18–21) n=9b |
| Interphasmid distance | 27.9±2.0 (25–31) | 35.0±8.3 (22–47) | 28.9±2.8 (25–33) | 33.3±3.5 (27–38) | 31.3±5.4 (22–47) | 28–31d |

Figure 4:
Light microphotographs of anterior portion of second-stage juveniles of studied M. arenaria populations. A: Isolate KR1-1; B: Isolate KN1-1; C: Isolate KhF1-2; D: Isolate KhF1-3. (All scale bars = 5 μm).

Figure 5:
Light microphotographs of tail of second-stage juveniles of studied M. arenaria. populations. A: Isolate KR1-1; B: Isolate KN1-1; C: Isolate KhF1-2; D: Isolate KhF1-3, arrow shows anus. (All scale bars = 5 μm).
Table 4.
Morphometricsa of second-stage juveniles of four populations of Meloidogyne arenaria from pistachio gardens in Iran and other populations. Measurements in μm.
| This study | Previous studies | |||||
|---|---|---|---|---|---|---|
| Character | KR1-1 | KN1-1 | KhF1-2 | KhF1-3 | Total | |
| n | 7 | 6 | 6 | 7 | 26 | |
| Body length | 464±48 (378–543) | 458±59 (393–537) | 355±24 (335–400) | 419±29 (390–460) | 425±58 (335–543) | 504±4.3b (392–605) |
| Body width | 16.3±2.1 (13.5–19.0) | 14.2±0.6 (13.5–15.0) | 16.6±2.3 (14.5–20.0) | 15.1±1.1 (14–17) | 15.5±1.8 (13.5–20.0) | 15.3±0.1b (13–18) |
| Stylet | 11.0±0.7 (10–12) | 11.3±0.5 (10.5–12.0) | 12.0±0.9 (11–13) | 11.4±0.8 (10.5–12.5) | 11.4±0.8 (10–13) | 11.1±0.03b (10–12) |
| DGO | 3.5±0.6 (3.0–4.5) | 3.2±0.3 (3.0–3.5) | 3.3±0.4 (3–4) | 3.1±0.2 (3.0–3.5) | 3.3±0.4 (3.0–4.5) | 3.7±0.04b (3–5) |
| Median bulb | 57±7.2 (52.5–73.0) | 54±1.8 (52–57) | 52.1±3.7 (48.5–58.0) | 56.1±3.1 (52.5–60.0) | 55.2±4.7 (48.5–73.0) | 60.9±0.43b (49.4–71.2) |
| Excretory pore to anterior end | 74.9±8.6 (56.5–80.0) | 77.1±9.2 (65–90) | 81.4±6.9 (75–92) | 77.9±6.9 (64–85) | 77.7±7.8 (56.5–92.0) | 89.8±0.56b (75.0–105.2) |
| Tail length | 47.9±4.8 (41–53) | 46.6±4.7 (38–51) | 42.2±6.2 (36.5–54.0) | 47.9±3.2 (45–54) | 46.3±5.1 (36.5–54.0) | 56.0±0.43b (44–59) |
| Hyaline | 16.6±2.7 (13–20) | 16.3±2.2 (14.0–19.5) | 13.3±1.5 (12–16) | 14.9±1.0 (13.5–16.0) | 15.3±2.3 (12–20) | 14.0±3.3c (10–21) n=17 |

Figure 6:
Amplification products generated from individual females with mitochondrial primer sets C2F3/1108. A) Ladder. B, C) Unique 1100-bp product if Meloidogyne arenaria, B isolate KhF1-2, C isolate KhF1-3, D) Unique about 1600-bp product of Meloidogyne javanica.

Figure 7:
Bayesian 50% majority rule consensus tree inferred from LSU rDNA D2-D3 segment of Meloidogyne arenaria populations recovered from pistachio gardens of Iran under the GTR + G + I model. Bayesian posterior probabilities (BPP) more than 50% are given for appropriate clades. Newly generate sequences are in bold font.

Figure 8:
Bayesian 50% majority rule consensus tree inferred from mitochondrial COII-16S segment of Meloidogyne arenaria populations recovered from pistachio gardens of Iran under the GTR + G + I model. Bayesian posterior probabilities (BPP) more than 50% are given for appropriate clades. Newly generated sequences are in bold font.

Figure 9:
Bayesian 50% majority rule consensus tree inferred from mitochondrial Nad5 segment of Meloidogyne arenaria recovered from pistachio gardens of Iran under the GTR + G + I model. Bayesian posterior probabilities (BPP) more than 50% are given for appropriate clades. Newly generated sequences are in bold font.