Skip to main content
Have a personal or library account? Click to login
Morphological and Molecular Characterization of Meloidogyne arenaria (Neal, 1889) Chitwood, 1949 Populations Parasitizing Pistachio in Kerman and Khorasan Razavi Provinces, Iran Cover

Morphological and Molecular Characterization of Meloidogyne arenaria (Neal, 1889) Chitwood, 1949 Populations Parasitizing Pistachio in Kerman and Khorasan Razavi Provinces, Iran

Open Access
|Oct 2024

Figures & Tables

Table 1.

Information of geographical distribution areas of Meloidogyne arenaria in two pistachio-growing provinces of Iran and newly generated sequences in present study.

Population codeSampling areaNELSU D2-D3 GenBank accession No.COII-16S GenBank accession No.Nad5 GenBank accession No.
KN1-1Kerman province, Nough30′58′24.0″55′35′35.8″-OR268637OR264475
KR1-1Kerman province, Rafsanjan30′25′17.0″55′49′40.9″-OR268638OR264476
KhF1-2Khorasan Razavi province, Feyzabad34′58′36.8″58′42′09.8″OR267403OR268639-
KhF1-3Khorasan Razavi province, Feyzabad34′57′14.0″58′39′28.1″OR267404OR268640OR264477
Table 2.

List of primers used for sequencing of different loci in the present study.

LocusPrimers5′ to 3′ SequenceReference
LSU rDNA D2-D3D2AbACAAGTACCGTGAGGGAAAGTTGDe Ley et al. (1999)
D3BTCGGAAGGAACCAGCTACTA
COII-16SC2F3GGTCAATGTTCAGAAATTTGTGGPowers and Harris (1993)
1108TACCTTTGACCAATCACGCT
NADH dehydrogenase subunit 5 (Nad5)NAD5FTATTTTTTGTTTGAGATATATTAGJanssen et al. (2016)
NAD5RCGTGAATCTTGATTTTCCATTTTT
Figure 1:

Photographs of root galls caused by Meloidogyne arenaria on pistachio in Kerman and Khorasan Razavi provinces, Iran. A: Irregular galls by isolate KR1-1; B: Irregular galls by KN1-1 isolate; C: Irregular galls by KhF1-2 isolate; D: Spheroid galls by KhF1-3 isolate. (All scale bars = 10 mm).

Figure 2:

Light microphotographs of stylet and cephalic region of Iranian population of M. arenaria (isolate KhF1-2). A: Stylet, B: Anterior body region, C: The excretory pore. (All scale bars = 10 μm).

Figure 3:

Light microphotographs of perineal patterns of studied M. arenaria populations. A, B: Isolate KR1-1; C, D: Isolate KN1-1; E, F: Isolate KhF1-2; G, H: Isolate KhF1-3; A, C, E, G: The dorsal arch is high; B, D, F, H: The dorsal arch is moderately high, phasmids are distinct. (All scale bars = 10 μm).

Table 3.

Morphometricsa of females of four Meloidogyne arenaria populations from pistachio gardens in Iran compared with other populations. Measurements in μm.

This studyPrevious studies
CharacterKR1-1KN1-1KhF1-2KhF1-3Total
n777728
Body length804.3±62.9 (720–890)849.3±46.0 (770–900)862.9±24.3 (840–900)875±44.3 (810–940)847.9±51.6 (720–940)741±115b (601–985)
Body width542.9±46.8 (480–590)628.6±27.3 (590–670)578.6±27.9 (550–620)649.3±31.7 (590–685)599.8±53.4 (480–685)448±89b (334–626)
Stylet16.6±0.6 (15.5–17.0)17.1±0.2 (17.0–17.5)16.6±0.5 (16–17)17.4±0.6 (17.0–18.5)16.9±0.6 (15.5–18.5)15.1±0.05c (13–17) n=150
DGO4.1±0.4 (3.5–4.5)5.4±0.7 (4–6)4.4±0.5 (4–5)4.9±0.4 (4.5–5.5)4.7±0.7 (3.5–6)4.8±0.06c (3.1–6.6) n=150
Excretory pore to anterior end41.0±5.4 (35–49)41.9±4.0 (39–50)36.3±3.9 (31–42)30.4±3.0 (25–34)37.4±6.1 (25–50)42.2±0.94c (18–80) n=150
Vulval slit23.1±1.6 (21–25)27.9±2.6 (25–33)21.2±1.8 (19–24)25.4±1.1 (24–27)24.4±3.1 (19–33)29.3±4.1 (24–37) n=9b
Vulva-anus16.6±1.4 (15–19)19.6±1.2 (18–21)19.1±2.0 (16.5–22.0)20.4±0.9 (19.0–21.5)18.9±1.9 (15–22)20.7±2.6 (18–21) n=9b
Interphasmid distance27.9±2.0 (25–31)35.0±8.3 (22–47)28.9±2.8 (25–33)33.3±3.5 (27–38)31.3±5.4 (22–47)28–31d

a Mean ± standard deviation (range).

Figure 4:

Light microphotographs of anterior portion of second-stage juveniles of studied M. arenaria populations. A: Isolate KR1-1; B: Isolate KN1-1; C: Isolate KhF1-2; D: Isolate KhF1-3. (All scale bars = 5 μm).

Figure 5:

Light microphotographs of tail of second-stage juveniles of studied M. arenaria. populations. A: Isolate KR1-1; B: Isolate KN1-1; C: Isolate KhF1-2; D: Isolate KhF1-3, arrow shows anus. (All scale bars = 5 μm).

Table 4.

Morphometricsa of second-stage juveniles of four populations of Meloidogyne arenaria from pistachio gardens in Iran and other populations. Measurements in μm.

This studyPrevious studies
CharacterKR1-1KN1-1KhF1-2KhF1-3Total
n766726
Body length464±48 (378–543)458±59 (393–537)355±24 (335–400)419±29 (390–460)425±58 (335–543)504±4.3b (392–605)
Body width16.3±2.1 (13.5–19.0)14.2±0.6 (13.5–15.0)16.6±2.3 (14.5–20.0)15.1±1.1 (14–17)15.5±1.8 (13.5–20.0)15.3±0.1b (13–18)
Stylet11.0±0.7 (10–12)11.3±0.5 (10.5–12.0)12.0±0.9 (11–13)11.4±0.8 (10.5–12.5)11.4±0.8 (10–13)11.1±0.03b (10–12)
DGO3.5±0.6 (3.0–4.5)3.2±0.3 (3.0–3.5)3.3±0.4 (3–4)3.1±0.2 (3.0–3.5)3.3±0.4 (3.0–4.5)3.7±0.04b (3–5)
Median bulb57±7.2 (52.5–73.0)54±1.8 (52–57)52.1±3.7 (48.5–58.0)56.1±3.1 (52.5–60.0)55.2±4.7 (48.5–73.0)60.9±0.43b (49.4–71.2)
Excretory pore to anterior end74.9±8.6 (56.5–80.0)77.1±9.2 (65–90)81.4±6.9 (75–92)77.9±6.9 (64–85)77.7±7.8 (56.5–92.0)89.8±0.56b (75.0–105.2)
Tail length47.9±4.8 (41–53)46.6±4.7 (38–51)42.2±6.2 (36.5–54.0)47.9±3.2 (45–54)46.3±5.1 (36.5–54.0)56.0±0.43b (44–59)
Hyaline16.6±2.7 (13–20)16.3±2.2 (14.0–19.5)13.3±1.5 (12–16)14.9±1.0 (13.5–16.0)15.3±2.3 (12–20)14.0±3.3c (10–21) n=17

a Mean ± standard deviation (range)

Figure 6:

Amplification products generated from individual females with mitochondrial primer sets C2F3/1108. A) Ladder. B, C) Unique 1100-bp product if Meloidogyne arenaria, B isolate KhF1-2, C isolate KhF1-3, D) Unique about 1600-bp product of Meloidogyne javanica.

Figure 7:

Bayesian 50% majority rule consensus tree inferred from LSU rDNA D2-D3 segment of Meloidogyne arenaria populations recovered from pistachio gardens of Iran under the GTR + G + I model. Bayesian posterior probabilities (BPP) more than 50% are given for appropriate clades. Newly generate sequences are in bold font.

Figure 8:

Bayesian 50% majority rule consensus tree inferred from mitochondrial COII-16S segment of Meloidogyne arenaria populations recovered from pistachio gardens of Iran under the GTR + G + I model. Bayesian posterior probabilities (BPP) more than 50% are given for appropriate clades. Newly generated sequences are in bold font.

Figure 9:

Bayesian 50% majority rule consensus tree inferred from mitochondrial Nad5 segment of Meloidogyne arenaria recovered from pistachio gardens of Iran under the GTR + G + I model. Bayesian posterior probabilities (BPP) more than 50% are given for appropriate clades. Newly generated sequences are in bold font.

DOI: https://doi.org/10.2478/jofnem-2024-0043 | Journal eISSN: 2640-396X | Journal ISSN: 0022-300X
Language: English
Submitted on: May 11, 2024
Published on: Oct 28, 2024
Published by: Society of Nematologists, Inc.
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year

© 2024 Fatemeh Shekari Mahoonaki, Esmat Mahdikhani Moghadam, Mohammad Zakiaghl, Mohammad Moradi, Majid Pedram, published by Society of Nematologists, Inc.
This work is licensed under the Creative Commons Attribution 4.0 License.