Depth distribution of plant-parasitic nematodes on bentgrass golf greens in Missouri and Indiana

State	City	Cultivar	Nematicides Previously Applied	Construction	pH	OM %	K (ppm)	Mg (ppm)	Ca (ppm)
MO/KC 2021
1	St. Louis	A4	None	USGA	6.9	1.3	40	82	471
2	St. Louis	T1/A4	None	USGA	N.A.	N.A.	N.A.	N.A.	N.A.
3	St. Louis	A1/A4	Heat-killed Burkholderia spp., Fluopyram	Native	N.A.	N.A.	N.A.	N.A.	N.A.
4	Columbia	A1	None	USGA	N.A.	N.A.	N.A.	N.A.	N.A.
5	Columbia	SR 1020	Heat-killed Burkholderia spp., Abamectin	USGA	7.8	0.6	49	126	634
6	Branson	Penn A1/A4	None	USGA	N.A.	N.A.	N.A.	N.A.	N.A.
7	Cape Girardeau	Crenshaw	Fluopyram	USGA	N.A.	N.A.	N.A.	N.A.	N.A.
8	Mission Hills	A1/A4	Fluopyram	USGA	7.3	1.4	30	72	628
9	Mission Hills	A1/A4 ~10% POA	Heat-killed Burkholderia spp., Abamectin	USGA	7.1	1.2	64	65	597
10	Olathe	A4/Pure Distinction	Abamectin, Fluopyram	USGA	7.2	1.3	53	62	678
Indiana 2022
1	Newburgh	Cohansey	None	USGA	7.4	1.1	20	51	476
2	French Lick	Penn A1/A4	None	USGA	7.9	1.0	16	35	1335
3	Columbus	Penncross	Abamectin	Native	7.5	1.6	59	93	1373
4	Indianapolis	Penncross ~20% Poa	None	USGA	7.5	2.5	49	113	1478
5	Noblesville	A1	None	USGA	7.8	N.A.	N.A.	N.A.	N.A.
6	Chesterton	Penncross/Poa (50/50)	None	USGA	7.8	1.2	21	77	890
7	Bristol	A1/A4/Poa	Fluopyram	Native	7.8	2.2	108	105	1809
8	Fort Wayne	Penncross/Poa	None	USGA	7.6	2.6	56	84	1609
9	Fort Wayne	007	None	USGA	7.5	1.6	40	138	1546
10	West Lafayette	L 39	None	USGA	7.9	1.7	30	80	1518

Table 2:

Species and isolates of lance nematodes sequenced in the present study.

DNA ID	Location	Host	Cultivar	Species	GenBank Accession Number
STL.1	Kirkwood, MO	Bentgrass	A1/A4	H. stephanus	OR948481
STL.2	Kirkwood, MO	Bentgrass	A1/A4	H. magnistylus	OR948484
STL.3	Kirkwood, MO	Bentgrass	A1/A4	H. stephanus	OR948486
STL.4	Kirkwood, MO	Bentgrass	A1/A4	H. stephanus	OR948495
STL.5	Kirkwood, MO	Bentgrass	A1/A4	H. stephanus	OR948498
STL.6	Kirkwood, MO	Bentgrass	A1/A4	H. magnistylus	OR948501
1.1	Newburgh, IN	Bentgrass	Cohansey	H. magnistylus	OR948481
1.2	Newburgh, IN	Bentgrass	Cohansey	H. magnistylus	OR948496
2.1	French Lick, IN	Bentgrass	Penn A1/A4	H. stephanus	OR948472
2.2	French Lick, IN	Bentgrass	Penn A1/A4	H. stephanus	OR948480
2.3	French Lick, IN	Bentgrass	Penn A1/A4	H. stephanus	OR948482
2.4	French Lick, IN	Bentgrass	Penn A1/A4	H. stephanus	OR948500
3.1	Columbus, IN	Bentgrass	Penncross	H. stephanus	OR948478
3.2	Columbus, IN	Bentgrass	Penncross	H. stephanus	OR948493
3.3	Columbus, IN	Bentgrass	Penncross	H. stephanus	OR948492
4.1	Indianapolis, IN	Bentgrass/~20% Poa	Penncross	H. stephanus	OR948475
4.2	Indianapolis, IN	Bentgrass/~20% Poa	Penncross	H. stephanus	OR948485
5.1	Noblesville, IN	Bentgrass	A1	H. stephanus	OR948476
6.1	Chesterton, IN	Bentgrass/Poa 50/50	Penncross	H. stephanus	OR948477
6.2	Chesterton, IN	Bentgrass/Poa 50/50	Penncross	H. stephanus	OR948487
7.1	Bristol, IN	Bentgrass/~20% Poa	A1/A4	H. stephanus	OR948497
10.1	West Lafayette, IN	Bentgrass	L 93	H. stephanus	OR948473
10.2	West Lafayette, IN	Bentgrass	L 93	H. stephanus	OR948474
10.3	West Lafayette, IN	Bentgrass	L 93	H. stephanus	OR948479
10.4	West Lafayette, IN	Bentgrass	L 93	H. stephanus	OR948483
10.5	West Lafayette, IN	Bentgrass	L 93	H. stephanus	OR948489
10.6	West Lafayette, IN	Bentgrass	L 93	H. stephanus	OR948490
10.7	West Lafayette, IN	Bentgrass	L 93	H. stephanus	OR948491
10.8	West Lafayette, IN	Bentgrass	L 93	H. stephanus	OR948494
10.9	West Lafayette, IN	Bentgrass	L 93	H. stephanus	OR948499
10.10	West Lafayette, IN	Bentgrass	L 93	H. magnistylus	OR948502
Root-Knot
DNA ID	Location	Host	Cultivar	Species	GenBank Accession Number
1.1	Newburgh, IN	Bentgrass	Cohansey	M. gramincola	PP034063
2.1	French Lick, IN	Bentgrass	Penn A1/A4	M. gramincola	PP034062
4.1	Indianapolis, IN	Bentgrass/~20% Poa	Penncross	M. marylandi	PP034064
4.2	Indianapolis, IN	Bentgrass/~20% Poa	Penncross	M. naasi	PP034066
5.1	Noblesville, IN	Bentgrass	A1	M. graminicola	PP034061
6.1	Chesterton, IN	Bentgrass/Poa 50/50	Penncross	M. marylandi	PP034071
7.1	Bristol, IN	Bentgrass/~20% Poa	A1/A4	M. marylandi	PP034065
7.2	Bristol, IN	Bentgrass/~20% Poa	A1/A4	M. naasi	PP034072
8.1	Fort Wayne, IN	Bentgrass/Poa 50/50	Penncross	M. naasi	PP034067
9.1	Fort Wayne, IN	Bentgrass	007	M. naasi	PP034069
10.1	West Lafayette, IN	Bentgrass	L 93	M. graminicola	PP034060
10.2	West Lafayette, IN	Bentgrass	L 93	M. naasi	PP034068
10.3	West Lafayette, IN	Bentgrass	L 93	M. naasi	PP034070

Table 3:

Hoplolaimus spp. reverse primers paired with Hoc-1f (1,19). Meloidogyne spp. primer pairs used in this study (36). All T_m (°C) fell between 55–65.

Hoplolaimus spp.
Species	Primer Code	Primer Sequence (5′-3′)	T_m (°C)	Size of PCR fragment (bp)
Hoplolaimus spp.	LSUD-03r	TATGCTTAAGTTCAGCGGGT	60	1,030
H. stephanus	Hs-1r	GCCAGTGTGTTCCGCTCGCA	63.2	260
H. stephanus	Hs-1f	CCTGCCTTGGGGGTCGCTTG	63.7	260
H. columbus	HC-1r	TCAGCACACAATGGTACCTTT	62	580
H. galeatus	HG-2r	TCCTCGTTCACACATTGACA	62	120
Meloidogyne spp.
Meloidogyne spp.(F)	RK28SF	CGGATAGAGTCGGCGTATC	55–60	612
Meloidogyne spp.(R)	MR	AACCGCTTCGGACTTCCACCAG
M. graminis(F)	Mg28SFs	GATGTGCAGATATTTTCCGTCAAGG	55–60	198
M. graminis(R)*	RK28SUR	CCCTATACCCAAGTCAGACGAT
M. marylandi(F)	MgmITSFs	GATCGTAAGACTTAATGAGCC	55–60	323
M. marylandi(R)*	RK28SUR	CCCTATACCCAAGTCAGACGAT
M. naasi(F)	Mn28SFs	GTCTGATGTGCGACCTTTCACTAT	55–60	272
M. naasi(R)*	RK28SUR	CCCTATACCCAAGTCAGACGAT
M. incognita(F)	Inc-K14-F	CCCGCTACACCCTCAACTTC	55–60	399
M. incognita(R)	Inc-K14-R	GGGATGTGTAAATGCTCCTG

Distribution of plant-parasitic nematode species sampled from creeping bentgrass putting greens in Missouri and eastern Kansas in 2021 and Indiana in 2022 in two independent pie charts. Samples were collected during the months of April, June, August and October of 2021 and 2022, respectively. “n” indicates total PPNs represented within each chart.

Table 4:

Type III Tests of Fixed Effects for both Missouri and eastern Kansas in 2021 and Indiana in 2022. Data were analyzed using PROC GLIMMIX in SAS 9.4

	Effect	Missouri	Indiana
Lance	Depth	<.0001	<.0001
	Month	.0028	.0003
	Depth x Month	.0487	.4981
Root-Knot	Depth	.0004	<.0001
	Month	.7918	<.0001
	Depth x Month	.9998	.5897
Ring	Depth	<.0001	<.0001
	Month	<.0001	<.0001
	Depth x Month	.0001	<.0001
Free-Living	Depth	<.0001	<.0001
	Month	.0538	.0025
	Depth x Month	.0254	<.0001

Table 5:

Missouri and eastern Kansas 2021 total nematode population densities by sampling depth and month with soil samples aggregated (100 cm³). Significance letters indicate significant differences between sampling depths by month analyzed within that individual species.

Sampling Depth (cm)
Species	Sampling Month	0–5		5.1–10		10.1–15		15.1–20		20.1–25
Lance	April	81.9^x	bcde^y	19.5	de	9.0	e	1.5	e	1.5	e
Lance	June	144.0	b	85.5	bcde	18.0	e	10.5	e	10.5	e
August	147.6	b	110.7	bc	53.1	cde	33.6	cde	21.3	cde
October	309.0	a	105.6	bcd	27.0	cde	24.9	cde	10.8	e
Root-Knot	April	162.9	^*	66.0	^*	14.4	^*	12.0	^*	3.0	^*
Root-Knot	June	97.5	^*	39.0	^*	4.5	^*	3.0	^*	13.5	^*
August	114.6	^*	25.5	^*	5.1	^*	4.5	^*	9.0	^*
October	185.4	^*	62.1	^*	11.4	^*	8.1	^*	15.9	^*
Ring	April	21.9	c	27.0	c	21.0	c	3.0	c	3.9	c
Ring	June	90.0	cb	64.5	cb	34.5	cb	13.5	c	18.0	c
August	171.3	b	97.5	cb	37.2	cb	17.7	c	23.1	cb
October	534.0	a	139.5	cb	62.7	cb	33.6	cb	18.3	cb
Free-Living	April	1188.9	c	238.5	c	80.4	c	43.8	c	43.8	c
Free-Living	June	3178.5	b	429.0	c	189.0	c	114.0	c	90.0	c
August	3187.2	b	306.7	c	154.2	c	108.3	c	143.1	c
October	4653.0	a	351.8	c	186.9	c	100.5	c	119.8	c

x Mean of nematode population densities per 100 cm³.

y Means in the same column followed by the same letter are not different according to Fisher's protected LSD (P ≤ 0.05).

* Indicates no significant depth by month interaction.

Table 6:

Indiana 2022 total nematode population densities organized by sampling depth and month with soil samples aggregated (100 cm³). Significance letters indicate significant differences between sampling depths by month analyzed within that individual species.

Sampling Depth (cm)
Species	Sampling Month	0–5		5.1–10		10.1–15		15.1–20		20.1–25
Lance	April	30.0^x	^*^y	37.5	^*	16.5	^*	18.0	^*	4.5	^*
Lance	June	16.5	^*	63.0	^*	13.5	^*	4.5	^*	3.0	^*
August	51.0	^*	54.0	^*	43.5	^*	34.5	^*	15.0	^*
October	10.5	^*	19.5	^*	16.5	^*	6.0	^*	4.5	^*
Root-Knot	April	424.5	^*	306.0	^*	229.5	^*	79.5	^*	48.0	^*
Root-Knot	June	145.5	^*	67.5	^*	19.5	^*	4.5	^*	0	^*
August	282.0	^*	132.0	^*	28.5	^*	27.0	^*	22.5	^*
October	70.5	^*	55.5	^*	18.0	^*	9	^*	7.5	^*
Ring	April	189.0	bcd	58.5	cde	21.0	de	19.5	de	16.5	e
Ring	June	337.5	b	153.0	cde	57.0	de	30.0	de	19.5	de
August	1017.9	a	220.5	bc	121.5	cde	61.5	cde	33.0	de
October	156.0	cde	57.0	cde	33.0	de	13.5	e	1.5	e
Free-Living	April	1591.5	b	316.5	c	129.0	c	73.5	c	58.5	c
Free-Living	June	4144.5	a	405.0	c	132.0	c	60.0	c	28.5	c
August	3559.5	a	343.5	c	160.5	c	61.5	c	60.0	c
October	913.5	bc	147.0	c	67.5	c	43.5	c	30.5	c

x Mean of nematode population densities per 100 cm³.

y Means in the same column followed by the same letter are not different according to Fisher's protected LSD (P ≤ 0.05).

* Indicates no significant depth by month interaction.

Phylogeny of the rDNA ITS region of *Hoplolaimus* spp. isolated from golf putting greens. Phylogenetic trees were constructed with the neighbor-joining algorithm using the Kimura two-parameter model with *Litylenchus* spp. (LC383724) as the outgroup. Bootstrap values are based on 1000 resamplings of the data set. DNAID codes correlate to Table 2.

PCR results using *Hoplolaimus*-specific and *H. stephanus*, *H. columbus* and *H. galeatus*-specific primers. DL: DNA Ladder; 1: *Hoplolaimus* spp. (DNA ID:10); 2: *H. stephanus* (DNA ID:10); 3: *H. columbus* (DNA ID:10); 4 *H. galeatus* (DNA ID:10); 5: *Hoplolaimus* spp. (DNA ID:3); 6: H. stephanus (DNA ID:3); 7: *H. columbus* (DNA ID:3); 8 *H. galeatus* (DNA ID:3); 9: *Hoplolaimus* spp. (DNA ID:4); 10: *H. stephanus* (DNA ID:4); 11: *H. columbus* (DNA ID:4); and 12 *H. galeatus* (DNA ID:4).

Scanning-electron micrographs of a lance nematode specimen collected form Site 5. A) four lip annules; B) the presence of an epiptygma; C) 25 longitudinal striae on the basal lip annule; and D) four lateral incisures.

Phylogeny of molecularly characterized *Meloidogyne* spp. isolated from golf coursed based on D2/D3 28S genes. phylogenetic trees were constructed with the neighbor-joining algorithm using the Kimura two-parameter model with *Litylenchus* spp. (LC383724) as the outgroup. Bootstrap values are based on 1000 resamplings of the data set and displayed near branch nodes. DNAID codes correlate to Table 2.

PCR results using *Meloidogyne*-specific and *M. naasi* and *M. marylandi*-specific primers. DL: DNA Ladder; 1: *Meloidogyne spp. (DNA ID:9); 2: M. naasi* (DNA ID:9); 3: *Meloidogyne* spp. (DNA ID:4); 4: *M. marylandi* (DNA ID:4); and 5: *Meloidogyne* spp.(DNA ID:4).

References

Authors

Metrics

Articles in this issue

DOI: https://doi.org/10.2478/jofnem-2024-0006 | Journal eISSN: 2640-396X | Journal ISSN: 0022-300X

Journal RSS Feed

Language: English

Submitted on: Oct 20, 2023

Published on: Mar 20, 2024

Published by: Society of Nematologists, Inc.

In partnership with: Paradigm Publishing Services

Publication frequency: 1 issue per year

Keywords:

Agrostis stolonifera,

Criconemoides spp.,

Hoplolaimus galeatus,

Hoplolaimus magnistylus,

Hoplolaimus spp.,

Hoplolaimus stephanus,

lance nematode,

management,

Meloidogyne graminicola,

Meloidogyne marylandi,

vertical distribution

Related subjects:

Life sciences,

Life sciences, other

© 2024 Asa L. McCurdy, Jefferson Barizon, G.L. Miller, published by Society of Nematologists, Inc.
This work is licensed under the Creative Commons Attribution 4.0 License.

Volume 56 (2024): Issue 1 (March 2024)

Depth distribution of plant-parasitic nematodes on bentgrass golf greens in Missouri and Indiana

Figures & Tables

Table 1:

Table 2:

Table 3:

Figure 1:

Table 4:

Table 5:

Table 6:

Figure 2:

Figure 3:

Figure 4:

Figure 5:

Figure 6:

Paradigm

My account