Effect of Vicia sativa L. on Motility, Mortality and Expression Levels of hsp Genes in J2 Stage of Meloidogyne hapla

Dobosz, Renata; Flis, Łukasz; Bocianowski, Jan; Malewski, Tadeusz

Effect of Vicia sativa L. on Motility, Mortality and Expression Levels of hsp Genes in J2 Stage of Meloidogyne hapla

Journal of Nematology

Volume 55 (2023): Issue 1 (February 2023)

By:

Renata Dobosz, Łukasz Flis, Jan Bocianowski and Tadeusz Malewski

Open Access

|Apr 2023

Figures & Tables

Dendrogram of the nearest neighbour cluster grouping of combinations of temperature, cultivars, and variants on the basis of four traits.

Distribution of 36 combinations of temperatures, cultivars, and variants in the space of the first two canonical variables.

Influence of Vicia sativa cv. Ina diffusate treatment on hsp gene expression in Meloidogyne hapla J2 stage. Each value represents the mean ± s.d. of three biological replicates. The expression levels are indicated as the fold-change normalized to the control (untreated diffusate), normalized to the value of 1 (dashed line). Values were expressed as the mean fold difference, and statistically significant differences between treated and control samples are shown; *p≤0.01 based on t-Student test.

Mobility of Meloidogyne hapla second-stage juveniles (J2) after exposed to water and Vicia sativa seed diffusates, and mortality after NaOH treatment_ In table we presented meand values [In %] and standard deviations - s_d_ [In %]_

Combination	Temperature	Cultivar	Variant	Immobile J2 after 24 h	Immobile J2 after 48 h	Immobile J2 immersed in water	Immobile J2 after NaOH treatment
				Mean ± s.d.	Mean ± s.d.	Mean ± s.d.	Mean ± s.d.
1	10°C	Ina	J2+H₂O	0 ± 0 i	0 ± 0 k	0 ± 0g	0 ± 0 f
2	10°C	Ina	J2+S+H₂O	34.72 ± 13.062 de	29.44 ± 12.936 hi	2.778 ± 1.297 ef	2.778 ± 1.297 de
3	10°C	Ina	J2+StS+H₂O	43.33 ± 12.713 c	30.56 ± 15.031 ghi	1.111 ±2.171 fg	1.111 ±2.171 ef
4	10°C	Ina	J2+RD	0 ± 0 i	0 ± 0 k	0±0g	0 ± 0 f
5	10°C	Ina	J2+S+RD	8.06 ± 4.597 h	22.22 ± 13.731 ij	1.389 ± 1.716 fg	1.667 ±2.247 ef
6	10°C	Ina	J2+StS+RD	20 ± 9.535 f	34.44 ±8.165 fgh	1.944 ± 1.716 fg	1.944 ± 1.716 ef
7	10°C	Jaga	J2+H₂O	0 ± 0 i	0 ± 0 k	0±0g	0 ± 0 f
8	10°C	Jaga	J2+S+H₂O	0 ± 0 i	0 ± 0 k	0±0g	0 ± 0 f
9	10°C	Jaga	J2+StS+H₂O	0 ± 0 i	0 ± 0 k	0±0g	0 ± 0 f
10	10°C	Jaga	J2+RD	0 ± 0 i	0 ± 0 k	0±0g	0 ± 0 f
11	10°C	Jaga	J2+S+RD	0 ± 0 i	0 ± 0 k	0±0g	0 ± 0 f
12	10°C	Jaga	J2+StS+RD	0 ± 0 i	0 ± 0 k	0±0g	0 ± 0 f
13	17°C	Ina	J2+H₂O	0 ± 0 i	0 ± 0 k	0±0g	0 ± 0 f
14	17°C	Ina	J2+S+H₂O	18.33 ± 10.2 fg	14.72 ± 19.667 j	0±0g	0 ± 0 f
15	17°C	Ina	J2+StS+H₂O	21.94 ± 15.6 f	24.72 ± 15.793 i	4.167 ±4.949 de	4.167 ± 4.949 d
16	17°C	Ina	J2+RD	0 ± 0 i	0 ± 0 k	0±0g	0 ± 0 f
17	17°C	Ina	J2+S+RD	36.39 ± 10.489 d	48.89 ± 15.33 d	0±0g	0 ± 0 f
18	17°C	Ina	J2+StS+ RD	36.11 ± 9.83 d	38.89 ± 14.094 efg	1.667 ±1.741 fg	1.667 ± 1.741 ef
19	17°C	Jaga	J2+ H₂O	0 ± 0 i	0 ± 0 k	0±0g	0 ± 0 f
20	17°C	Jaga	J2+S+H₂O	0 ± 0 i	0 ± 0 k	0±0g	0 ± 0 f
21	17°C	Jaga	J2+StS+H₂O	0 ± 0 i	0 ± 0 k	0±0g	0 ± 0 f
22	17°C	Jaga	J2+RD	0 ± 0 i	0 ± 0 k	0±0g	0 ± 0 f
23	17°C	Jaga	J2+S+ RD	0 ± 0 i	45.83 ± 14.848 de	1.667 ±2.247 fg	1.667 ±2.247 ef
24	17°C	Jaga	J2+StS+RD	0 ± 0 i	39.17 ± 14.293 efg	0.556 ± 1.297 g	0.556 ± 1.297 f
25	21 °C	Ina	J2+H₂O	0 ± 0 i	0 ± 0 k	0±0g	0 ± 0 f
26	21°C	Ina	J2+S+H₂0	17.78 ± 10.184 fg	39.72 ± 11.322 ef	7.778 ±4.103 c	7.778 ±4.103 c
27	21°C	Ina	J2+StS+H₂O	29.44 ± 9.727 e	38.33 ± 9.924 efg	29.167 ± 10.648 a	29.167 ± 10.648 a
28	21°C	Ina	J2+RD	0 ± 0 i	0 ± 0 k	0±0g	0 ± 0 f
29	21°C	Ina	J2+S+RD	53.61 ± 14.387 b	71.11 ± 22.398 c	1.389 ± 1.716 fg	1.389 ± 1.716 ef
30	21°C	Ina	J2+StS+RD	100 ± 0 a	100 ± 0 a	0.556 ± 1.297 g	0.556 ± 1.297 f
31	21°C	Jaga	J2+H₂O	0 ± 0 i	0 ± 0 k	0±0g	0 ± 0 f
32	21°C	Jaga	J2+S+H₂O	14.44 ± 7.566 g	44.17 ± 15.707 de	6.944 ±3.001 cd	6.944 ± 3.001 c
33	21°C	Jaga	J2+StS+H₂O	16.67 ±6.816 fg	15.56 ± 7.698 j	10.556 ± 7.083 b	10.556 ± 7.083 b
34	21°C	Jaga	J2+RD	0 ± 0 i	0 ± 0 k	0 ± 0 g	0 ± 0 f
35	21°C	Jaga	J2+S+RD	20.83 ± 6.376 f	100 ± 0 a	2.778 ±3.978 ef	2.778 ± 3.978 de
36	21°C	Jaga	J2+StS+RD	18.33 ± 8.704 fg	84.17 ± 24.168 b	1.667 ± 2.659 fg	1.667 ±2.659 ef
LSD0.05				5.39	8.795	2.171	2.18

Mean squares [%2] from three-way analysis of variance for observed traits_

Source of variation	d.f.	Immobile J2 after 24 h	Immobile J2 after 48 h	Immobile J2 immersed in water	Immobile J2 after NaOH treatment
Temperature (T)	2	8723.15***	38277.8***	943.39***	938.374***
Cultivar (C)	1	40703.81***	8983.6***	257.202***	262.371***
Variant (V)	5	9691.42***	34681.6***	583.498***	582.31***
TC	2	159.67*	3219.1***	47.557**	47.016**
TV	10	3228.36***	7990.8***	440.458***	441.152***
CV	5	5546.58***	2276.7***	184.671***	183.297***
TCV	10	2071.8***	884.7***	104.192***	104.979***
Residual	396	45.1	120.1	7.319	7.377

List of primers used in the study_

Primer	Seq 5´ to 3´- Forward	Seq 5´ to 3´ - Reverse
Mh-hsp90	TCTCTGATGATGAGGCTGAAGA	TCACCGTCCTTCTTGTCCTT
Mh-hsp1	ACTCATCTTGGTGGTGAAGATT	TCAATGCCATCAAAGAGAGAATCA
Mh-hsp60	TTCCTGCTCTTGAATTGGCT	AATTGTGACTTCATCCGCCT
Mh-hsp43	CGTAGAGAAGAATTCCGTGAAGA	TTCAGAGCGGTGACTTCCA
Mh-hsp12.3	GCCTCTCCAGCATAATGACG	CGATTTATTTCACGACTGACTGA

Correlation coefficients between observed traits_

Trait	Immobile J2 after 24 h	Immobile J2 after 48 h	Immobile J2 immersed in water	Immobile J2 after NaOH treatment
Immobile J2 after 24 h	1
Iimmobile J2 after 48 h	0.7419***	1
Immobile J2 immersed in water	0.2069	0.2241	1
Immobile treatment J2 after NaOH	0.2066	0.2241	1***	1

Meloidogyne hapla genes homologous to Caenorhabditis elegans hsp genes (based on WormBase version: WS246)_

Hsp family	Gene C. elegans (Transcript ID)	Gene M. hapla (Transcript ID)	Gene location on contig
Hsp90	hsp90 (C47E8.5)	MhA1_Contig1972.frz3.gene3	4732..7425
Hsp70	hsp1 (F26D10.3)	MhA1_Contig113.frz3.gene45	79493..86067
Hsp60	hsp60 (Y22D7AL.5)	MhA1_Contig737.frz3.gene23	48523..50607
sHsps	hsp43 (C14F11.5)	MhA1_Contig30.frz3.gene18	50262..54876
sHsps	hsp12.3 (F38E11.1)	MhA1_Contig199.frz3.gene23	35708..36080

DOI: https://doi.org/10.2478/jofnem-2023-0009 | Journal eISSN: 2640-396X | Journal ISSN: 0022-300X

Journal RSS Feed

Language: English

Submitted on: May 9, 2022

Published on: Apr 14, 2023

Published by: Society of Nematologists, Inc.

In partnership with: Paradigm Publishing Services

Publication frequency: 1 issue per year

Keywords:

genes,

Related subjects:

© 2023 Renata Dobosz, Łukasz Flis, Jan Bocianowski, Tadeusz Malewski, published by Society of Nematologists, Inc.
This work is licensed under the Creative Commons Attribution 4.0 License.

Previous article Volume 55 (2023): Issue 1 (February 2023)Next article

Effect of Vicia sativa L. on Motility, Mortality and Expression Levels of hsp Genes in J2 Stage of Meloidogyne hapla

Figures & Tables

Figure 1

Figure 2

Figure 3

Mobility of Meloidogyne hapla second-stage juveniles (J2) after exposed to water and Vicia sativa seed diffusates, and mortality after NaOH treatment_ In table we presented meand values [In %] and standard deviations - s_d_ [In %]_

Mean squares [%2] from three-way analysis of variance for observed traits_

List of primers used in the study_

Correlation coefficients between observed traits_

Meloidogyne hapla genes homologous to Caenorhabditis elegans hsp genes (based on WormBase version: WS246)_

Paradigm

My account