Table 1
Mean squares [%2] from three-way analysis of variance for observed traits.
| Source of variation | d.f. | Immobile J2 after 24 h | Immobile J2 after 48 h | Immobile J2 immersed in water | Immobile J2 after NaOH treatment |
|---|---|---|---|---|---|
| Temperature (T) | 2 | 8723.15*** | 38277.8*** | 943.39*** | 938.374*** |
| Cultivar (C) | 1 | 40703.81*** | 8983.6*** | 257.202*** | 262.371*** |
| Variant (V) | 5 | 9691.42*** | 34681.6*** | 583.498*** | 582.31*** |
| TC | 2 | 159.67* | 3219.1*** | 47.557** | 47.016** |
| TV | 10 | 3228.36*** | 7990.8*** | 440.458*** | 441.152*** |
| CV | 5 | 5546.58*** | 2276.7*** | 184.671*** | 183.297*** |
| TCV | 10 | 2071.8*** | 884.7*** | 104.192*** | 104.979*** |
| Residual | 396 | 45.1 | 120.1 | 7.319 | 7.377 |
[i] *P<0.05; **P<0.01; ***P<0.001; d.f. – the number of degrees of freedom.
Table 2
Mobility of Meloidogyne hapla second-stage juveniles (J2) after exposed to water and Vicia sativa seed diffusates, and mortality after NaOH treatment. In table we presented meand values [In %] and standard deviations - s.d. [In %].
| Combination | Temperature | Cultivar | Variant | Immobile J2 after 24 h | Immobile J2 after 48 h | Immobile J2 immersed in water | Immobile J2 after NaOH treatment |
|---|---|---|---|---|---|---|---|
| Mean ± s.d. | Mean ± s.d. | Mean ± s.d. | Mean ± s.d. | ||||
| 1 | 10°C | Ina | J2+H2O | 0 ± 0 i | 0 ± 0 k | 0 ± 0g | 0 ± 0 f |
| 2 | 10°C | Ina | J2+S+H2O | 34.72 ± 13.062 de | 29.44 ± 12.936 hi | 2.778 ± 1.297 ef | 2.778 ± 1.297 de |
| 3 | 10°C | Ina | J2+StS+H2O | 43.33 ± 12.713 c | 30.56 ± 15.031 ghi | 1.111 ±2.171 fg | 1.111 ±2.171 ef |
| 4 | 10°C | Ina | J2+RD | 0 ± 0 i | 0 ± 0 k | 0±0g | 0 ± 0 f |
| 5 | 10°C | Ina | J2+S+RD | 8.06 ± 4.597 h | 22.22 ± 13.731 ij | 1.389 ± 1.716 fg | 1.667 ±2.247 ef |
| 6 | 10°C | Ina | J2+StS+RD | 20 ± 9.535 f | 34.44 ±8.165 fgh | 1.944 ± 1.716 fg | 1.944 ± 1.716 ef |
| 7 | 10°C | Jaga | J2+H2O | 0 ± 0 i | 0 ± 0 k | 0±0g | 0 ± 0 f |
| 8 | 10°C | Jaga | J2+S+H2O | 0 ± 0 i | 0 ± 0 k | 0±0g | 0 ± 0 f |
| 9 | 10°C | Jaga | J2+StS+H2O | 0 ± 0 i | 0 ± 0 k | 0±0g | 0 ± 0 f |
| 10 | 10°C | Jaga | J2+RD | 0 ± 0 i | 0 ± 0 k | 0±0g | 0 ± 0 f |
| 11 | 10°C | Jaga | J2+S+RD | 0 ± 0 i | 0 ± 0 k | 0±0g | 0 ± 0 f |
| 12 | 10°C | Jaga | J2+StS+RD | 0 ± 0 i | 0 ± 0 k | 0±0g | 0 ± 0 f |
| 13 | 17°C | Ina | J2+H2O | 0 ± 0 i | 0 ± 0 k | 0±0g | 0 ± 0 f |
| 14 | 17°C | Ina | J2+S+H2O | 18.33 ± 10.2 fg | 14.72 ± 19.667 j | 0±0g | 0 ± 0 f |
| 15 | 17°C | Ina | J2+StS+H2O | 21.94 ± 15.6 f | 24.72 ± 15.793 i | 4.167 ±4.949 de | 4.167 ± 4.949 d |
| 16 | 17°C | Ina | J2+RD | 0 ± 0 i | 0 ± 0 k | 0±0g | 0 ± 0 f |
| 17 | 17°C | Ina | J2+S+RD | 36.39 ± 10.489 d | 48.89 ± 15.33 d | 0±0g | 0 ± 0 f |
| 18 | 17°C | Ina | J2+StS+ RD | 36.11 ± 9.83 d | 38.89 ± 14.094 efg | 1.667 ±1.741 fg | 1.667 ± 1.741 ef |
| 19 | 17°C | Jaga | J2+ H2O | 0 ± 0 i | 0 ± 0 k | 0±0g | 0 ± 0 f |
| 20 | 17°C | Jaga | J2+S+H2O | 0 ± 0 i | 0 ± 0 k | 0±0g | 0 ± 0 f |
| 21 | 17°C | Jaga | J2+StS+H2O | 0 ± 0 i | 0 ± 0 k | 0±0g | 0 ± 0 f |
| 22 | 17°C | Jaga | J2+RD | 0 ± 0 i | 0 ± 0 k | 0±0g | 0 ± 0 f |
| 23 | 17°C | Jaga | J2+S+ RD | 0 ± 0 i | 45.83 ± 14.848 de | 1.667 ±2.247 fg | 1.667 ±2.247 ef |
| 24 | 17°C | Jaga | J2+StS+RD | 0 ± 0 i | 39.17 ± 14.293 efg | 0.556 ± 1.297 g | 0.556 ± 1.297 f |
| 25 | 21 °C | Ina | J2+H2O | 0 ± 0 i | 0 ± 0 k | 0±0g | 0 ± 0 f |
| 26 | 21°C | Ina | J2+S+H20 | 17.78 ± 10.184 fg | 39.72 ± 11.322 ef | 7.778 ±4.103 c | 7.778 ±4.103 c |
| 27 | 21°C | Ina | J2+StS+H2O | 29.44 ± 9.727 e | 38.33 ± 9.924 efg | 29.167 ± 10.648 a | 29.167 ± 10.648 a |
| 28 | 21°C | Ina | J2+RD | 0 ± 0 i | 0 ± 0 k | 0±0g | 0 ± 0 f |
| 29 | 21°C | Ina | J2+S+RD | 53.61 ± 14.387 b | 71.11 ± 22.398 c | 1.389 ± 1.716 fg | 1.389 ± 1.716 ef |
| 30 | 21°C | Ina | J2+StS+RD | 100 ± 0 a | 100 ± 0 a | 0.556 ± 1.297 g | 0.556 ± 1.297 f |
| 31 | 21°C | Jaga | J2+H2O | 0 ± 0 i | 0 ± 0 k | 0±0g | 0 ± 0 f |
| 32 | 21°C | Jaga | J2+S+H2O | 14.44 ± 7.566 g | 44.17 ± 15.707 de | 6.944 ±3.001 cd | 6.944 ± 3.001 c |
| 33 | 21°C | Jaga | J2+StS+H2O | 16.67 ±6.816 fg | 15.56 ± 7.698 j | 10.556 ± 7.083 b | 10.556 ± 7.083 b |
| 34 | 21°C | Jaga | J2+RD | 0 ± 0 i | 0 ± 0 k | 0 ± 0 g | 0 ± 0 f |
| 35 | 21°C | Jaga | J2+S+RD | 20.83 ± 6.376 f | 100 ± 0 a | 2.778 ±3.978 ef | 2.778 ± 3.978 de |
| 36 | 21°C | Jaga | J2+StS+RD | 18.33 ± 8.704 fg | 84.17 ± 24.168 b | 1.667 ± 2.659 fg | 1.667 ±2.659 ef |
| LSD0.05 | 5.39 | 8.795 | 2.171 | 2.18 |
[i] *J2+H20 - juveniles of second stage immersed in water; J2+S+H2O - juveniles of second stage Immersed in seeds diffusates of Vicia sativa In water; J2+StS+H2O - juveniles of second stage immersed in surface-sterilized seeds diffusates of Vicia sativa in water; J2+RD - juveniles of second stage Immersed in root diffusates of S. iycopersicum-, J2+S+RD - juveniles of second stage immersed in seeds diffusates of Vicia sativa In root diffusates of S. iycopersicum-, J2+StS+RD - juveniles of second stage immersed in surface-sterilized seeds diffusates of Vicia sativa in root diffusates of S. iycopersicum. Means followed by the same letter are not statistically different.
Table 3
Correlation coefficients between observed traits.
| Trait | Immobile J2 after 24 h | Immobile J2 after 48 h | Immobile J2 immersed in water | Immobile J2 after NaOH treatment |
|---|---|---|---|---|
| Immobile J2 after 24 h | 1 | |||
| Iimmobile J2 after 48 h | 0.7419*** | 1 | ||
| Immobile J2 immersed in water | 0.2069 | 0.2241 | 1 | |
| Immobile treatment J2 after NaOH | 0.2066 | 0.2241 | 1*** | 1 |
[i] ***P<0.001.

Figure 1
Dendrogram of the nearest neighbour cluster grouping of combinations of temperature, cultivars, and variants on the basis of four traits.

Figure 2
Distribution of 36 combinations of temperatures, cultivars, and variants in the space of the first two canonical variables.
Table 4
Meloidogyne hapla genes homologous to Caenorhabditis elegans hsp genes (based on WormBase version: WS246).
| Hsp family | Gene C. elegans (Transcript ID) | Gene M. hapla (Transcript ID) | Gene location on contig |
|---|---|---|---|
| Hsp90 | hsp90 (C47E8.5) | MhA1_Contig1972.frz3.gene3 | 4732..7425 |
| Hsp70 | hsp1 (F26D10.3) | MhA1_Contig113.frz3.gene45 | 79493..86067 |
| Hsp60 | hsp60 (Y22D7AL.5) | MhA1_Contig737.frz3.gene23 | 48523..50607 |
| sHsps | hsp43 (C14F11.5) | MhA1_Contig30.frz3.gene18 | 50262..54876 |
| sHsps | hsp12.3 (F38E11.1) | MhA1_Contig199.frz3.gene23 | 35708..36080 |
Table 5
List of primers used in the study.
| Primer | Seq 5´ to 3´- Forward | Seq 5´ to 3´ - Reverse |
|---|---|---|
| Mh-hsp90 | TCTCTGATGATGAGGCTGAAGA | TCACCGTCCTTCTTGTCCTT |
| Mh-hsp1 | ACTCATCTTGGTGGTGAAGATT | TCAATGCCATCAAAGAGAGAATCA |
| Mh-hsp60 | TTCCTGCTCTTGAATTGGCT | AATTGTGACTTCATCCGCCT |
| Mh-hsp43 | CGTAGAGAAGAATTCCGTGAAGA | TTCAGAGCGGTGACTTCCA |
| Mh-hsp12.3 | GCCTCTCCAGCATAATGACG | CGATTTATTTCACGACTGACTGA |

Figure 3
Influence of Vicia sativa cv. Ina diffusate treatment on hsp gene expression in Meloidogyne hapla J2 stage. Each value represents the mean ± s.d. of three biological replicates. The expression levels are indicated as the fold-change normalized to the control (untreated diffusate), normalized to the value of 1 (dashed line). Values were expressed as the mean fold difference, and statistically significant differences between treated and control samples are shown; *p≤0.01 based on t-Student test.