Skip to main content
Have a personal or library account? Click to login
Effect of Vicia sativa L. on Motility, Mortality and Expression Levels of hsp Genes in J2 Stage of Meloidogyne hapla Cover

Effect of Vicia sativa L. on Motility, Mortality and Expression Levels of hsp Genes in J2 Stage of Meloidogyne hapla

Open Access
|Apr 2023

Figures & Tables

Figure 1

Dendrogram of the nearest neighbour cluster grouping of combinations of temperature, cultivars, and variants on the basis of four traits.

Figure 2

Distribution of 36 combinations of temperatures, cultivars, and variants in the space of the first two canonical variables.

Figure 3

Influence of Vicia sativa cv. Ina diffusate treatment on hsp gene expression in Meloidogyne hapla J2 stage. Each value represents the mean ± s.d. of three biological replicates. The expression levels are indicated as the fold-change normalized to the control (untreated diffusate), normalized to the value of 1 (dashed line). Values were expressed as the mean fold difference, and statistically significant differences between treated and control samples are shown; *p≤0.01 based on t-Student test.

Mobility of Meloidogyne hapla second-stage juveniles (J2) after exposed to water and Vicia sativa seed diffusates, and mortality after NaOH treatment_ In table we presented meand values [In %] and standard deviations - s_d_ [In %]_

CombinationTemperatureCultivarVariantImmobile J2 after 24 hImmobile J2 after 48 hImmobile J2 immersed in waterImmobile J2 after NaOH treatment
Mean ± s.d.Mean ± s.d.Mean ± s.d.Mean ± s.d.
110°CInaJ2+H2O0 ± 0 i0 ± 0 k0 ± 0g0 ± 0 f
210°CInaJ2+S+H2O34.72 ± 13.062 de29.44 ± 12.936 hi2.778 ± 1.297 ef2.778 ± 1.297 de
310°CInaJ2+StS+H2O43.33 ± 12.713 c30.56 ± 15.031 ghi1.111 ±2.171 fg1.111 ±2.171 ef
410°CInaJ2+RD0 ± 0 i0 ± 0 k0±0g0 ± 0 f
510°CInaJ2+S+RD8.06 ± 4.597 h22.22 ± 13.731 ij1.389 ± 1.716 fg1.667 ±2.247 ef
610°CInaJ2+StS+RD20 ± 9.535 f34.44 ±8.165 fgh1.944 ± 1.716 fg1.944 ± 1.716 ef
710°CJagaJ2+H2O0 ± 0 i0 ± 0 k0±0g0 ± 0 f
810°CJagaJ2+S+H2O0 ± 0 i0 ± 0 k0±0g0 ± 0 f
910°CJagaJ2+StS+H2O0 ± 0 i0 ± 0 k0±0g0 ± 0 f
1010°CJagaJ2+RD0 ± 0 i0 ± 0 k0±0g0 ± 0 f
1110°CJagaJ2+S+RD0 ± 0 i0 ± 0 k0±0g0 ± 0 f
1210°CJagaJ2+StS+RD0 ± 0 i0 ± 0 k0±0g0 ± 0 f
1317°CInaJ2+H2O0 ± 0 i0 ± 0 k0±0g0 ± 0 f
1417°CInaJ2+S+H2O18.33 ± 10.2 fg14.72 ± 19.667 j0±0g0 ± 0 f
1517°CInaJ2+StS+H2O21.94 ± 15.6 f24.72 ± 15.793 i4.167 ±4.949 de4.167 ± 4.949 d
1617°CInaJ2+RD0 ± 0 i0 ± 0 k0±0g0 ± 0 f
1717°CInaJ2+S+RD36.39 ± 10.489 d48.89 ± 15.33 d0±0g0 ± 0 f
1817°CInaJ2+StS+ RD36.11 ± 9.83 d38.89 ± 14.094 efg1.667 ±1.741 fg1.667 ± 1.741 ef
1917°CJagaJ2+ H2O0 ± 0 i0 ± 0 k0±0g0 ± 0 f
2017°CJagaJ2+S+H2O0 ± 0 i0 ± 0 k0±0g0 ± 0 f
2117°CJagaJ2+StS+H2O0 ± 0 i0 ± 0 k0±0g0 ± 0 f
2217°CJagaJ2+RD0 ± 0 i0 ± 0 k0±0g0 ± 0 f
2317°CJagaJ2+S+ RD0 ± 0 i45.83 ± 14.848 de1.667 ±2.247 fg1.667 ±2.247 ef
2417°CJagaJ2+StS+RD0 ± 0 i39.17 ± 14.293 efg0.556 ± 1.297 g0.556 ± 1.297 f
2521 °CInaJ2+H2O0 ± 0 i0 ± 0 k0±0g0 ± 0 f
2621°CInaJ2+S+H2017.78 ± 10.184 fg39.72 ± 11.322 ef7.778 ±4.103 c7.778 ±4.103 c
2721°CInaJ2+StS+H2O29.44 ± 9.727 e38.33 ± 9.924 efg29.167 ± 10.648 a29.167 ± 10.648 a
2821°CInaJ2+RD0 ± 0 i0 ± 0 k0±0g0 ± 0 f
2921°CInaJ2+S+RD53.61 ± 14.387 b71.11 ± 22.398 c1.389 ± 1.716 fg1.389 ± 1.716 ef
3021°CInaJ2+StS+RD100 ± 0 a100 ± 0 a0.556 ± 1.297 g0.556 ± 1.297 f
3121°CJagaJ2+H2O0 ± 0 i0 ± 0 k0±0g0 ± 0 f
3221°CJagaJ2+S+H2O14.44 ± 7.566 g44.17 ± 15.707 de6.944 ±3.001 cd6.944 ± 3.001 c
3321°CJagaJ2+StS+H2O16.67 ±6.816 fg15.56 ± 7.698 j10.556 ± 7.083 b10.556 ± 7.083 b
3421°CJagaJ2+RD0 ± 0 i0 ± 0 k0 ± 0 g0 ± 0 f
3521°CJagaJ2+S+RD20.83 ± 6.376 f100 ± 0 a2.778 ±3.978 ef2.778 ± 3.978 de
3621°CJagaJ2+StS+RD18.33 ± 8.704 fg84.17 ± 24.168 b1.667 ± 2.659 fg1.667 ±2.659 ef
LSD0.05 5.398.7952.1712.18

Mean squares [%2] from three-way analysis of variance for observed traits_

Source of variationd.f.Immobile J2 after 24 hImmobile J2 after 48 hImmobile J2 immersed in waterImmobile J2 after NaOH treatment
Temperature (T)28723.15***38277.8***943.39***938.374***
Cultivar (C)140703.81***8983.6***257.202***262.371***
Variant (V)59691.42***34681.6***583.498***582.31***
TC2159.67*3219.1***47.557**47.016**
TV103228.36***7990.8***440.458***441.152***
CV55546.58***2276.7***184.671***183.297***
TCV102071.8***884.7***104.192***104.979***
Residual39645.1120.17.3197.377

List of primers used in the study_

PrimerSeq 5´ to 3´- ForwardSeq 5´ to 3´ - Reverse
Mh-hsp90TCTCTGATGATGAGGCTGAAGATCACCGTCCTTCTTGTCCTT
Mh-hsp1ACTCATCTTGGTGGTGAAGATTTCAATGCCATCAAAGAGAGAATCA
Mh-hsp60TTCCTGCTCTTGAATTGGCTAATTGTGACTTCATCCGCCT
Mh-hsp43CGTAGAGAAGAATTCCGTGAAGATTCAGAGCGGTGACTTCCA
Mh-hsp12.3GCCTCTCCAGCATAATGACGCGATTTATTTCACGACTGACTGA

Correlation coefficients between observed traits_

TraitImmobile J2 after 24 hImmobile J2 after 48 hImmobile J2 immersed in waterImmobile J2 after NaOH treatment
Immobile J2 after 24 h1
Iimmobile J2 after 48 h0.7419***1
Immobile J2 immersed in water0.20690.22411
Immobile treatment J2 after NaOH0.20660.22411***1

Meloidogyne hapla genes homologous to Caenorhabditis elegans hsp genes (based on WormBase version: WS246)_

Hsp familyGene C. elegans (Transcript ID)Gene M. hapla (Transcript ID)Gene location on contig
Hsp90hsp90 (C47E8.5)MhA1_Contig1972.frz3.gene34732..7425
Hsp70hsp1 (F26D10.3)MhA1_Contig113.frz3.gene4579493..86067
Hsp60hsp60 (Y22D7AL.5)MhA1_Contig737.frz3.gene2348523..50607
sHspshsp43 (C14F11.5)MhA1_Contig30.frz3.gene1850262..54876
sHspshsp12.3 (F38E11.1)MhA1_Contig199.frz3.gene2335708..36080
DOI: https://doi.org/10.2478/jofnem-2023-0009 | Journal eISSN: 2640-396X | Journal ISSN: 0022-300X
Language: English
Submitted on: May 9, 2022
Published on: Apr 14, 2023
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year

© 2023 Renata Dobosz, Łukasz Flis, Jan Bocianowski, Tadeusz Malewski, published by Society of Nematologists, Inc.
This work is licensed under the Creative Commons Attribution 4.0 License.