Figure 1
Figure 2
Influence of the number of nematodes used for DNA extraction on the quantification cycle (Cq) values in Ditylenchus dipsaci and D_ weischeri real-time PCR assays, showing the mean Cq values ± SD_
| Species | Number of nematodes | D. dipsaci (OG0014442) | D. dipsaci (OG0014782) | D. weischeri (OG0018807) | D. weischeri (OG0020570) |
|---|---|---|---|---|---|
| D. E-105 dipsaci | 10 nematodes | 29.12 ± 0.22 | 27.93 ± 0.13 | ND | ND |
| 5 nematodes | 31.24 ± 0.74 | 29.98 ± 1.21 | ND | ND | |
| 1 nematode | 32.40 ± 1.79 | 32.57 ± 1.76 | ND | ND | |
| D. S-100 weischeri | 10 nematodes | ND | ND | 28.94 ± 0.18 | 29.80 ± 0.57 |
| 5 nematodes | ND | ND | 30.20 ± 0.61 | 31.29 ± 0.55 | |
| 1 nematode | ND | ND | 32.98 ± 1.78 | 34.21 ± 1.84 |
Nematode isolates used for real-time PCR in this study_
| Species | Strain name | Host | Origin |
|---|---|---|---|
| Ditylenchus dipsaci | C-100 | Garlic | Clemson, USA |
| Ditylenchus dipsaci | E-105 | Garlic | Ontario, Canada |
| Ditylenchus dipsaci | G-137 | Garlic | Ontario, Canada |
| Ditylenchus weischeri | O-100 | Creeping thistle | Ontario, Canada |
| Ditylenchus weischeri | S-100 | Creeping thistle | Saskatchewan, Canada |
| Ditylenchus destructor | J-100 | Sweet potato | Jiangsu, China |
| Ditylenchus destructor | O-101 | Garlic | Ontario, Canada |
| Ditylenchus africanus | D-afri-South-Afr | Unknown | South Africa |
| Ditylenchus sp. | Dity-sp-Jord-ONT | Turf | Ontario, Canada |
| Litylenchus crenatae | Lity-cren-ONT-01 | Beech tree leaf | Ontario, Canada |
Real-Time PCR primers and probes developed for D_ dipsaci and D_ weischeri_
| Species | Orthogroup ID | Primer or probe name | Sequence (5 -3) | Optimized final concentration (nM) | Product size (bp) |
|---|---|---|---|---|---|
| Ditylenchus dipsaci | OG0014442 | Dp-OG0014442-F | TCCTGCTCCACTATCAACACTTC | 100 | 108 |
| Dp-OG0014442-R | CAGACGATAAGCTTGTTCATTGGA | 800 | |||
| Dp-OG0014442-P | TGGTCGTTATATGCTCAGCAAGGGAATGC | 100 | |||
| OG0014782 | Dp-OG0014782-F | CATTAGATCGTGTAGCTTGCGAG | 200 | 122 | |
| Dp-OG0014782-R | AGCCATCCAATTGATCGATCGTA | 800 | |||
| Dp-OG0014782-P | AGGGATCTGACAGAATTCGACTACCGCA | 100 | |||
| Dityienchus weischeri | OG0018807 | Dw-OG0018807-F | GCCCGACGAGCTATTATTATCAC | 100 | 137 |
| Dw-OG0018807-R | GTAGAGGCTTTCATCCTGACCAA | 800 | |||
| Dw-OG0018807-P | TTGAGAATGAGTCCCACTACAACGCCCA | 100 | |||
| OG0020570 | DW-OG0020570-F | AACGGAGAAGTCAGTCAAGTTGT | 100 | 125 | |
| DW-OG0020570-R | ATTCCTCATGCGTGAATTTCAGC | 400 | |||
| DW-OG0020570-P | AATCTTCCACAATCGCTGCGCAATCCT | 100 |
Genome statistics for Ditylenchus dipsaci and D_ weischeri_
| Sample | Estimated sequencing coverage | No. of contigs | Largest contig (bp) | Total length (Mb) | GC (%) | N50 (bp) | L50 | No. of gaps per 100 kb | No. of genes predicted | No. of complete BUSCOs |
|---|---|---|---|---|---|---|---|---|---|---|
| D. dipsaci C-100 | 118 | 2,256 | 1,471,657 | 228.2 | 37.5 | 227,010 | 265 | 0 | 24,896 | 2,025 (64.7%) |
| D. dipsaci E-105s | 42 | 1,394 | 3,685,767 | 227.2 | 37.5 | 287,390 | 200 | 2.28 | 24,931 | 1,555 (49.7%) |
| D. dipsaci G-137 | 93 | 5,530 | 716,842 | 239.5 | 37.5 | 84,485 | 809 | 0 | 27,365 | 1,952 (62.4%) |
| D. weischeri 0-100 | 113 | 1,715 | 878,229 | 177.0 | 37.8 | 169,855 | 311 | 0 | 21,403 | 1,743 (55.7%) |
| D. weischeri S-100 | 129 | 2,012 | 1,555,244 | 196.3 | 37.9 | 192,952 | 282 | 0 | 25,930 | 1,816 (58.0%) |
Ditylenchus dipsaci and D_ weischeri real-time PCR assay results with the mean quantification cycle (Cq) values ± SD_
| Species | Input DNA | D. dipsaci (OG0014442) | D. dipsaci (OG0014782) | D. weischeri (OG0018807) | D. weischeri (OG0020570) |
|---|---|---|---|---|---|
| D. dipsaci C-100 | ~1 ng/ul | 26.42 ± 0.04 | 27.22 ± 0.05 | – | – |
| D. dipsaci E-105 | ~1 ng/ul | 26.08 ± 0.17 | 25.91 ± 0.08 | – | – |
| D. dipsaci G-137 | ~1 ng/ul | 25.16 ± 0.07 | 24.29 ± 0.03 | – | – |
| D. weischeri O-100 | ~1 ng/ul | – | – | 25.05 ± 0.03 | 25.15 ± 0.05 |
| D. weischeri S-100 | ~1 ng/ul | – | – | 25.26 ± 0.04 | 25.53 ± 0.05 |
| D. destructor J-100 | ~1 ng/ul | – | 36.74 ± 0.47 | – | – |
| D. destructor O-101 | ~1 ng/ul | 35.08 ± 1.55 | 37.59 ± 1.47 | – | – |
| D. D-afri-africanus South-Afr | 5 nematodes | – | – | – | – |
| Ditylenchus Dity-sp-Jord-sp. ONT | 5 nematodes | – | – | – | – |
| Litylenchus crenatae Lity-cren-ONT-01 | 1 or 10 nematodes | – | – | – | – |
| D. D. dipsaci weischeri + pooled | ~1 ng/ul | 27.25 ± 0.06 | 26.88 ± 0.01 | 26.48 ± 0.07 | 26.45 ± 0.25 |
| D. dipsaci + D. destructor pooled | ~1 ng/ul | 27.55 ± 0.03 | 27.07 ± 0.08 | – | – |
| D. weischeri + D. destructor pooled | ~1 ng/ul | 37.62 ± 0.21 | 38.055 ± 0.46 | 26.64 ± 0.14 | 26.86 ± 0.05 |
| D. dipsaci + D. weischeri + D. destructor pooled | ∼1 ng/ul | 27.88 ± 0.06 | 27.5 ± 0.03 | 26.87 ± 0.04 | 26.97 ± 0.03 |