Have a personal or library account? Click to login
Influence of the Type of Pollen Diet on the Survival, Body Weight, and Immune Response in the African Honeybee Cover

Influence of the Type of Pollen Diet on the Survival, Body Weight, and Immune Response in the African Honeybee

Open Access
|Jun 2022

Figures & Tables

Fig. 1

Survival analysis for different feeding regimens.Black dashed line - highly diverse (HD) pollen diet, blue dotted line - lowly diverse (LD) pollen diet.
Survival analysis for different feeding regimens.Black dashed line - highly diverse (HD) pollen diet, blue dotted line - lowly diverse (LD) pollen diet.

Fig. 2

Correlation of daily pollen consumption and daily weight change for (a) highly diverse (HD) pollen diet and (b) lowly diverse (LD) pollen diet).
Correlation of daily pollen consumption and daily weight change for (a) highly diverse (HD) pollen diet and (b) lowly diverse (LD) pollen diet).

Fig. S1

Protein content of different pollen diets. HD – highly diverse pollen diet, LD – lowly diverse pollen diet.
Protein content of different pollen diets. HD – highly diverse pollen diet, LD – lowly diverse pollen diet.

Fig. S2

Interaction plot for a) pollen consumption and b) daily bee body weight from day 1–5.Blue line - highly diverse (HD) pollen diet, orange line - lowly diverse (LD) pollen diet.
Interaction plot for a) pollen consumption and b) daily bee body weight from day 1–5.Blue line - highly diverse (HD) pollen diet, orange line - lowly diverse (LD) pollen diet.

Characteristics of the pollen used to create different pollen diets_ The high diversity (HD) pollen diet was created by mixing all 10 pollen types at equal frequency while the low diversity (LD) pollen diet consisted exclusively of pollen type 1_

List of primers for TBP and Defensin-2_

Gene IDPrimerAmplicon size (bp)Annealing temperature (°C)Primer reference
Tata Binding Protein (TBP)F: TTGGTTTCATTAGCTGCACAAR: ACTGCGGGAGTCAAATCTTC14953.5Tesovnik et al., 2017
defensin-2F: GCAACTACCGCCTTTACGTCR: GGGTAACGTGCGACGTTTTA15955.0Tesovnik et al., 2017
DOI: https://doi.org/10.2478/jas-2022-0003 | Journal eISSN: 2299-4831 | Journal ISSN: 1643-4439
Language: English
Page range: 29 - 43
Submitted on: May 25, 2021
|
Accepted on: Jan 20, 2022
|
Published on: Jun 22, 2022
In partnership with: Paradigm Publishing Services
Publication frequency: 2 issues per year

© 2022 Michael N. K. Muturi, Joel L. Bargul, H. Michael G. Lattorff, published by Research Institute of Horticulture
This work is licensed under the Creative Commons Attribution 4.0 License.