Skip to main content
Have a personal or library account? Click to login
Influence of the Type of Pollen Diet on the Survival, Body Weight, and Immune Response in the African Honeybee Cover

Influence of the Type of Pollen Diet on the Survival, Body Weight, and Immune Response in the African Honeybee

Open Access
|Jun 2022

Full Article

INTRODUCTION

Honeybees share a mutual relationship with the plants in their habitats. Plants rely on the pollination services offered by honeybees for their reproduction and survival. Honeybees, in turn, accrue nutritional benefits from plants (de Sá-Otero et al., 2009). The bees’ nutrition is composed of plant-derived nectar and pollen (Roulston & Cane, 2000; Nicolson & Thornburg, 2007). Whereas nectar acts as the main carbohydrate source, pollen is the primary protein source for developing larvae and adult honeybees (Brodschneider & Crailsheim, 2010). The nutritional content of pollen varies with the host-plant species with some pollen species being nutritionally richer than others (Maurizio & Louveaux, 1965; Odoux et al., 2012), with noticeable differences in their protein, amino acid, lipid, micronutrient, and sugar content (Keller et al., 2005; Roulston & Cane, 2000).

The nutritional composition of pollen influences the foraging preferences of bees (de Sá-Otero et al., 2009). Honeybees are generalists collecting a diversity of polyfloral pollen constituting a balanced and optimal diet (Schmidt, 1984; Schmidt et al., 1987). Intensified agricultural practices and urbanization are contributing to the loss of pollen sources for honeybees. Consequently, rich habitats endowed with polyfloral pollen sources are slowly being altered towards habitats with unifloral (for monocultures) or few floral sources (Decourtye et al., 2010; Naug, 2009). This limits the quality and feeding choice of the honeybee, a trend also being witnessed in sub-Saharan Africa (Nkonya et al., 2016).

Multiple studies have already been conducted to investigate the effect of both a pollen and a no-pollen diet on the honeybee (Schmidt, 1984; Schmidt et al., 1987; Pernal & Currie 2000). Furthermore, there have been extensive studies on the effects of polyfloral versus monofloral pollen diet on the European honeybee subspecies in the northern Hemisphere (Schmidt, 1984; Schmidt et al., 1987; Danihlík et al., 2018; Dolezal et al., 2019), but to the best of our knowledge, this is little understood in African honeybees, including the widely distributed sub-species of Apis mellifera scutellata (Hepburn & Radloff, 1998). Our present study utilized two pollen diets mimicking varying natural environments: (i) Highly diverse pollen diet reflecting a rich biodiversity (here abbreviated as HD), and (ii) Lowly diverse pollen diet corresponding to a degraded environment with fewer floral sources (abbreviated as LD).

This study aimed to answer the following research questions: (i) What are the survival rates of honeybees fed on lowly diverse relative to highly diverse pollen diets?, (ii) How do different pollen diets affect the body weight and pollen consumption rates of honeybees?, (iii) Does variation in pollen diversity influence the immune gene responses in honeybees? To answer these questions, newly emerged honeybees were fed with different pollen regimens, and measured parameters related to the physiology as weight, immune response and survival were assessed. We hypothesized that the honeybees fed on highly diverse pollen would show increased survival and immunity. This study is important in understanding the dietary requirements of the African honeybee and its physiological responses to varying diversities of pollen diets.

MATERIAL AND METHODS

Honeybee samples

This study was conducted at the International Centre of Insect Physiology and Ecology (icipe), Nairobi, Kenya (1.22°S, 36.89°E), from August 2018 to April 2020. Honeybee workers used in the study were obtained from three colonies maintained at the icipe experimental apiary. The colonies were headed by naturally mated queens and kept in standard Langstroth hives with ten frames. The local honeybee colonies belonged to the African honeybee subspecies A. m. scutellata (Muli et al., 2014).

Establishment of laboratory honeybee colonies

Age-matched honeybees were obtained using sealed brood combs containing late-stage pupae which were incubated overnight at 34±2°C and 50–70% relative humidity (Williams et al., 2013). The newly emerged workers (less than 24 h old) were transferred into cages and kept in an incubator at 34±2°C and 50–70% relative humidity. We used metal cages measuring 10 cm × 8.5 cm × 5 cm and circular plastic cages measuring 12 cm diameter × 8 cm height accompanied by their feeders to confine cohorts of five and 50 honeybees, respectively.

Adult honeybees were fed ad libitum with one of the following diets: (i) Lowly diverse (LD) pollen and sugar solution (1 g icing sugar in 2 ml water, 50 % w/v), (ii) Highly diverse (HD) pollen and sugar solution. Each cage was also supplied with 2 ml of water and all cages were inspected daily to replace the food and water as well as remove any dead bees. At least eight cages (replicate by cages) were used for each feeding assay. Pollen feeding in all setups was continued for six days.

Pollen preparation and identification

We used commercially available corbicular pollen (Aurica Naturheilmittel und Naturwaren GmbH, Schwalbach-Elm, Germany, originally collected from Spain) because locally available pollen was insufficient for the experimental setups. The pollen loads were hand-sorted based on color and appearance. Further on, using microscopy, we examined the hand-sorted pollen loads to verify whether they were also morphologically distinct. We obtained a total of ten pollen morphotypes (Tab. S2). The pollen types were later constituted into two pollen diets: LD pollen consisting of a single pollen type and HD pollen comprising of ten pollen types at equal frequency. The pollen diets were immediately frozen at −20°C until use.

Protein content of pollen

We analyzed the protein content of the pollen diets using the Bradford method with minor modifications (Bradford, 1976). Pollen was sampled from the daily food supplied to the bees kept in the metallic cages (n=5 bees). Each pollen sample was crushed into a fine powder using a pestle and mortar, transferred to a micro-centrifuge tube, and weighed on (Analytical Plus, Ohaus, Switzerland) a weighing balance (accuracy ±0.0001 g). Applying the method used by de Sá-Otero et al., (2009) with slight modifications (Ochungo et al., 2021), we extracted protein from the samples. Briefly, 5 ml of 30 mM TE-buffer was added to each sample, vortexed, and centrifuged for 10 min at 3,000 × g. We collected the supernatant in aliquots of 0.3 mL, added 4 mL of Bradford reagent and incubated the reaction mixture for 2 min at room temperature. This procedure was done in triplicates.

We used 0.3 mL of TE buffer as blank and Bovine Serum Albumin (BSA) (Sigma-Aldrich-Kobian, Kenya) as the standard (concentration 2 mg/mL). Then, to the various BSA dilutions prepared: 50 μg/mL, 150 μg/mL, 200 μg/mL, 250 μg/mL, and 400 μg/mL, we added 4 mL of Bradford reagent. Protein absorbances were measured at 595 nm using a Bio Spec-mini spectrophotometer (Shimadzu Corporation, Japan). We used absorbance values of the standards to generate a calibration curve and its corresponding linear formula. From this formula, we obtained crude protein values (μg protein/mL of pollen) and afterwards converted them to g protein/100 g pollen. We used a total of 19 and 16 replicates for HD and LD diets respectively.

Assay for determining honeybee body weight, pollen consumption, and bee survival

We marked honeybees kept in small metallic cages in groups of five bees per cage with different paint marks on their thoraces and weighed them to record the initial weight of individual bees using a weighing balance (Analytical Plus, Ohaus, Switzerland) (accuracy ±0.0001 g). The honeybees were subjected to different diet regimens (LD and HD). We recorded the weight of the individual honeybees daily before supplying a fresh diet into the cages. To do this, we placed individual bees in a 1.5 mL Eppendorf tube and subtracted the weight of the empty tube from the total weight of the tube + weighed bee. Previous studies had measured the weight of whole cages (Harbo & Hoopingarner, 1997; Harbo & Harris, 1999), but we were interested in the individual body weight of honeybees. Since the bees were colour-marked, we recorded the weight of individual bees in all cages daily. We further estimated the weight of the daily pollen consumption per cage after collecting the remaining diet the next day. This experimental setup was replicated four times. To ascertain the effect of pollen diets on survival, we kept groups of 50 honeybees in plastic cages. Daily inspection of the bees was conducted to remove and score the number of dead honeybees as well as renew the food and water supply. We terminated the experimental setups when all honeybees in the cages died. We replicated the experiment four times.

Setup for immune gene expression studies

For the immune gene expression assay, we set up cages each consisting of 50 freshly emerged honeybee workers. Subsequently, the bees received either of the two pollen treatments for six days and this experiment was conducted in triplicates. We changed the food and removed dead bees daily. On day six, we harvested ten bees per cage by freeze-killing at −80°C. These samples remained frozen until further processing.

RNA extraction, cDNA synthesis, and qRT-PCR

Total RNA was isolated from individual bees (n=30 bees for each treatment group) in order to quantify the expression of the target immune gene. This involved grounding the honeybee abdominal tissues in liquid nitrogen for RNA isolation using TRIzol (Invitrogen, USA) as described by Evans et al. (2013). RNA samples were quantified based on absorbance at 260 nm using a NanodropTM 2000 spectrophotometer (Thermofisher Scientific, USA) and quality was inferred from 260/280 nm ratio as well as from 230/260 nm ratio. We used 10 μL total RNA to synthesize cDNA using the High-Capacity cDNA Reverse Transcription Kit that contained oligo-dT primers (Applied Biosystems, Lithuania) according to the manufacturer’s instruction. The thermal conditions for the reaction were 25°C for 10 min, 37°C for 120 min, and 85°C for 5 min on T100TM Thermal Cycler (Bio-Rad, Singapore). We pooled equal volumes of cDNA (10 μL) from two bees per treatment group as a template for qRT-PCR reactions.

We conducted quantitative real-time PCR (qRT-PCR) on 96-well microtitre plates using HOT FIREPol EvaGreen® qPCR Mix Plus with ROX (Solis Biodyne, Estonia) and gene-specific primers (Tab. S1) for defensin-2 as the immune gene and tata binding protein (TBP) as a housekeeping gene. A total reaction volume of 10 μL consisted of 2 μL Eva Green Ready Mix (5x), 0.5 μL each primer pair (10 μM), 6 μL RNase-free water, and 1 μL cDNA sample (~100 ng/μL). For each reaction, we included a no template negative control and used two technical replicates. qRT-PCR was performed using the QuantStudio™ 3 System (Life Technologies Holding Pte Ltd, Singapore), under the thermocycling conditions: initial activation (95°C for 30 s), denaturation (95°C for 30 s), annealing (gene-specific temperature in Tab. S1; for 30 s), extension (72°C for 30 s), and final extension (72°C for 10 min) running for 40 cycles. The fluorescence was measured during the annealing step.

Statistical analyses

We tested all data for normality using the Shapiro-Wilks test. Since all our data were non-normally distributed, we used non-parametric tests for analysis. To compare differences in protein content between the LD and HD pollen diets, we used the Mann-Whitney-U-Test. We used the Cox proportional-hazard regression analysis as implemented in the survival (Therneau, 2020) and survminer (Kassambara et al., 2020) packages to compare the survival of the caged bees exposed to different diets. We compared the daily pollen consumption per cage for bees using a generalized linear mixed model (GLMM) with the type of diet, feeding day, and their interaction as fixed factors and cage nested in replicate as random factors implemented in the lme4 package within the R environment (Bates et al., 2015). Similarly, we compared the daily bee body weight using a GLMM including bee ID as an additional random factor nested in cage. We analysed the relationship between daily pollen consumption per bee and daily body weight change (loss/gain) using a Spearman rank correlation for each of the treatments separately. Day 6 was excluded from our analysis because several cages lacked surviving bees.

Tata Binding Protein (TBP) served as a housekeeping gene (HKG), and defensin-2 (def-2) as the target gene (TG). Fluorescence measurements obtained during amplification were imported to LinReg 2020.0 (Ruijter et al., 2009). LinReg generated the quantitation cycle (Cq), equivalent to cycle threshold (CT) and the PCR efficiency for each sample. The stability of TBP was determined using Reffinder (Xie et al., 2012). For assessing relative gene expression, we normalized the target gene expression values to the HKG expression levels. To compare the ratio between the expression of def-2 and TBP, we used the following formula

R=(ETGCT TG)/(EHKGCT HKG)
where: ETG - PCR efficiency of def-2, EHKG - PCR efficiency of TBP, CT TG - cycle threshold of def-2, and CT HKG - cycle threshold of TBP (Pfaffl 2001). The PCR efficiency obtained from LinReg replaced the optimal PCR efficiency of 2. The relative expression values were log2-transformed. To analyze the differences in gene expression, we used the Mann-Whitney U-test. We calculated the power of the statistical test using G-Power (Faul et al., 2007).

We performed all our statistical analyses using R software 3.6.2 version (R Core Team 2020) with appropriate packages: survival, survminer, and lme4. For all tests, we assumed a level of significance at p<0.05.

RESULTS

Protein content

The protein content of the different pollen diets was similar (LD pollen: 5.3±4.4 mg/100 mg, HD pollen: 5.6±7.3 mg/100 mg; Mann-Whitney U-test: w=210, p=0.52; Fig. S1).

Survival

HD pollen diet significantly increased the lifespan of the bees relative to those supplied with the LD pollen diet (Cox hazard proportion test; Cox log-rank score=10.56; beta HR=0.34; df=1; p=0.001; Fig. 1).

Fig. 1

Survival analysis for different feeding regimens.

Black dashed line - highly diverse (HD) pollen diet, blue dotted line - lowly diverse (LD) pollen diet.

Pollen consumption and bodyweight

HD pollen consumption per day ranged between 0.3 mg - 14 mg, while daily LD pollen consumption ranged between 0.4 mg-11.5 mg. HD-fed bees showed a higher pollen consumption relative to LD-fed bees across the days (Fig. S2a). The null model only including random effects (cage and replicate) was better than our full model (GLMM: LRT: 0.4532 p=0.32; AIC: null model: −338.74; full model: −335.57) implying that the fixed effects, feeding day and diet, and their interaction had no significant effect on daily pollen consumption.

The range in individual bodyweight of HD-fed bees was 59.6 mg - 101.7 mg and LD-fed bees 48.9 mg - 109.5 mg. LD and HD-fed bees shared a common trend from day 1–3. After day 3, the HD-reared bees experienced a decrease in weight persisting to day 4 before slightly increasing towards day 5 (Fig. S2b). The LD-reared bees recorded an onward sharp increase in weight past day 3 up to day 5 (Fig. S2b). Bee weight was affected by the feeding day (GLMM: df=7, t=−4.948, p<0.0001) and not by the type of diet (GLMM: df=7, t=0.972, p=0.33) or interaction between the two factors (GLMM; df=7, t=−1.720, p=0.09). HD pollen consumption was correlated to the bee weight gain as marginally significant (r=0.9, p=0.08), while this effect was less strong in LD (r=0.7, p=0.23) (Fig. 2).

Fig. 2

Correlation of daily pollen consumption and daily weight change for (a) highly diverse (HD) pollen diet and (b) lowly diverse (LD) pollen diet).

Immune gene expression

LD pollen diet increased the expression levels of def-2 more than the HD pollen but this was not significant (p=0.32). The mean ± standard deviation values for the expression levels in HD and LD-fed bees, respectively, were HD (4.9±4.12) and LD (6.7±2.61).

DISCUSSION

Diet comparisons can be investigated at two levels (i) pollen vs. no-pollen diet, and (ii) HD vs. LD pollen diet. Previous studies have already investigated the effect of the 1st level of comparison on honeybee health (Schmidt, 1984; Schmidt et al., 1987; Pernal & Currie 2000). We instead focused on the influence of the 2nd level of comparison, the quality of the pollen diet, by comparing the HD vs. LD pollen diet on bee health. We attempted to answer whether pollen quality sourced from two environments, namely lowly diverse habitat and rich biodiverse habitat, influences honeybee development and wellbeing. Our study, therefore, highlighted the effects of these two different pollen diets on the honeybee-related parameters of survival, bee body weight change, pollen consumption and immune response.

The LD pollen consisted of one predominant pollen based on colour, while the HD pollen was a blend of ten equally frequent pollen morphotypes verified by microscopic examination (Tab. S2). Pollen types can share the same colour shade yet belong to different plant species owing to other morphological differences in shape, size, and weight (Almeida-Muradian et al., 2005; Komosinska-Vassev et al., 2015).

The protein values for both pollen types were, on average, within the acceptable range of 2.5%–61% (Roulston et al., 2000). However, we attribute the low amount of crude protein values to the stored, dried pollen that was used in this study. Drying pollen significantly reduces the crude protein content of pollen (Human & Nicolson, 2006). LD-fed bees received the same quantity of protein as HD-fed bees. Although the method used, Bradford assay, provides a general guideline on the protein quality, it is limited to determining the number of specific amino acids (Pernal & Currie, 2000). Therefore, we propose that any difference elicited in the phenotype of the bees is due to differing amounts of amino acids and fatty acids in the pollen. Previously, different pollen types had been reported to share a similar concentration of proteins yet differ in their amino acids and fatty acids concentration (DeGrandi-Hoffman et al., 2018). This could have drastic implications for either a sufficiency or scarcity of essential amino acids such as tryptophan and phenylalanine (Roulston & Cane, 2000).

The longer lifespan registered by the HD-fed bees could be attributed to the nutritional differences in the two pollen regimens apart from the protein content. Pollen also contains fatty acids and micronutrients in varying amounts and composition in different pollen types (Keller et al., 2005; Di Pasquale et al., 2013). Polyfloral pollen is composed of pollen obtained from different floral sources, which collectively influences honeybee nutrition (Donkersley et al., 2017). Our findings coincide with previous reports which demonstrated that caged bees fed on polyfloral pollen survived longer than their counterparts on monofloral pollen (Schmidt et al., 1987; Di Pasquale et al., 2013; Dolezal et al., 2019). A polyfloral diet mimics the natural pollen diet used by honeybees (Schmidt et al., 1987). Honeybees are generalists that collect diverse multifloral pollen from different plant species to constitute a balanced and diverse diet (Dimou & Thrasyvoulou, 2009). A high protein diet seems to boost the honeybee’s survival even under stressful conditions (Archer et al., 2014). In field studies, the quality and availability of pollen have been shown to influence colony survival and productivity. Both, low amounts of pollen food stores and pollen of low nutritional value makes brood-rearing difficult (Kleinschmidt & Kondos, 1976; Brodschneider & Crailsheim, 2010) and might even lead to absconding (Cheruiyot et al., 2020). A noticeable increase in pollen consumption in HD- and LD-fed bees in the first three days was consistent with other studies (Alqarni, 2006). Possibly, this increased appetite was to meet the nutritional demands of the honeybees during this early, critical phase of growth and development. Pollen diet is crucial for the first seven days of adult honeybee development (Brodschneider & Crailsheim, 2010). In addition, it promotes hypopharyngeal gland development in brood and young bees (Di Pasquale et al., 2013) and determines the lifespan of honeybee workers (Amdam & Omholt, 2002).

The honeybees fed under the LD pollen regimen consumed a lower amount of pollen. The pollen consumed is a reliable measure of the palatability of the diet (Pernal & Currie, 2000). We propose that this reduced palatability in the LD diet could be associated with its poor unbalanced nutritional state. LD-fed bees would be expected to ingest more pollen to compensate for any lacking nutrients. However, honeybees do not ingest more of a poor pollen diet to compensate for any nutritional deficiencies in their diet or counter stressful conditions (Knox et al., 1971; Archer et al., 2014). If they are forcefully fed, this results in lowered survival and compromises health status (Paoli et al., 2014). Under field conditions, whether bees evaluate which pollen to consume is presently unclear. While foragers have been shown to select nutritionally dense pollen (Hendriksma & Shafir, 2016), nurse bees do not evaluate their choice of pollen diet based on nutrition (Corby-Harris et al., 2018). Noteworthy is that besides the nutritional quality of pollen, the amount of pollen consumed is determined by physical and chemical cues (Schmidt & Johnson, 1984), including phagostimulants which occur in different combinations for different pollen types (Schmidt, 1985).

LD-fed bees increased in weight over time. However, there is a relatively weaker correlation of change in body weight to the pollen they consumed relative to the HD-fed bees. The higher weight recorded could not be traced only to pollen consumed. We suggest that the LD-fed bees reverted to ingesting more of the additional sugar solution supplied possibly to compensate for the nutritional deficiency in the LD diet. Previously, honeybees under laboratory conditions had been reported to regulate their nutrient intake by shifting to a carbohydrate-biased diet (Altaye et al., 2010). However, sugar-solution consumption was not quantified in this study.

We used a low number of bees (n=5) because individual weighing generally induces stress in bees (Sgolastra et al., 2017); a previous study had used a similar number of bees (Arien et al., 2018). We measured the pollen consumption and bee bodyweight up to day five as some cages had no surviving bees on day 6. Eusocial honeybees endure stress when kept in small numbers resulting in a shorter survival period (Rinderer & Baxter, 1978). Furthermore, in ants, isolated ones (n=1 or 2) were more hyperactive and increased their energy demand compared to grouped ants (n=10), thus leading to higher mortality (Koto et al., 2015). In bumblebees, isolated bees showed a reduced immune response compared to bees kept in groups (Richter et al., 2012).

Def-2 was not significantly expressed in the HD and LD diet comparison. We chose def-2 as it is an important gene that codes for antimicrobial peptides, and previous studies showed a strong up-regulation under pathogen exposure (Erler et al., 2011; Ilyasov et al., 2012; Li et al., 2017). For newly emerged bees fed with pollen for six days, their immune system at the baseline level seems to be unrelated to the quality of the diet. A closer look at the survival curve reveals a significant difference in mortality after day 6. This phenotypic difference could imply a genotypic difference. Thus, a significant difference in def-2 gene expression would be expected if bees analysed were from day 7 onwards. Another possible explanation to the result obtained is that the activation of the immune system in honeybees is an energy-consuming process (Moret & Schmid-Hempel, 2000; Laughton et al., 2011). Honeybees, like other insects, will mount an immune system when it is only necessary, i.e., upon pathogen exposure or an immunological challenge (Tyler et al., 2006). When the immune system is stimulated, other bee genera including Bombus have been shown to consume more food. This compensates for the significant amount of energy investment needed for mounting an immune response (Tyler et al., 2006).

In summary, although HD and LD pollen diets appear to be similar in their protein quantity, there were detectable differences in their influence on the survival and physiology of the caged honeybees. Our findings reveal that the HD pollen diet was consumed more than the LD pollen diet and promoted higher survivorship as we had hypothesized. Besides proteins, pollen is packed with fatty acids and lipids alongside micronutrients which vary with the pollen type.

Our HD pollen diet, polyfloral in its composition, possibly supplied macro- and micronutrients lacking in the LD pollen diet. Our pollen consumption results reveal that LD-fed bees did not ingest more pollen than the HD-fed bees to compensate for any nutritional deficiencies. Finally, we noted a stronger correlation of bee weight and pollen consumption in the HD-fed bees than in the LD-fed bees, which implies a highly diverse pollen diet has a stronger influence on honeybee physiology. Further investigation is required to determine the effect of individual pollen morphotypes on the survival and physiology of the African bee.

Our study conducted under laboratory conditions mimics two contrasting habitats and their possible effect on honeybee life-history traits and physiology. The findings support the concept that honeybees in highly degraded habitats are nutritionally deprived of an optimum diet unlike those in diverse and intact environments. Under malnourished conditions, honeybees shift their feeding patterns besides being more susceptible to other environmental stressors acting synergistically with malnutrition. Thus, existing diverse environments need to be conserved as a prerequisite for securing the health of the honeybee and other pollinators to ensure optimum delivery of the ecosystem service of pollination.

ACKNOWLEDGMENTS

The authors are grateful to the entire team of the Environmental Health Theme for their support. Special thanks to our research field technicians James N. Kimani and Joseph W. Kilonzo for their support in collecting bee samples from the field. Hosea O. Mokaya, L. Allan Okwaro, and Pamela Ochungo for their helpful comments on the manuscript. We gratefully acknowledge the financial support for this research by the following organizations and agencies: JRS Biodiversity Foundation (grant number: 60610); UK’s Foreign, Commonwealth & Development Office (FCDO); the Swedish International Development Cooperation Agency (Sida); the Swiss Agency for Development and Cooperation (SDC); the Federal Democratic Republic of Ethiopia; and the Government of the Republic of Kenya.

JLB is supported by DELTAS Africa Initiative grant # DEL-15-011 to THRiVE-2. The DELTAS Africa Initiative is an independent funding scheme of the African Academy of Sciences (AAS)’s Alliance for Accelerating Excellence in Science in Africa (AESA) and supported by the New Partnership for Africa’s Development Planning and Coordinating Agency (NEPAD Agency) with funding from the Welcome Trust grant # 107742/Z/15/Z and the UK government. The views expressed herein do not necessarily reflect the official opinion of the donors.

SUPPLEMENTARY MATERIAL

Table S1

List of primers for TBP and Defensin-2.

Gene IDPrimerAmplicon size (bp)Annealing temperature (°C)Primer reference
Tata Binding Protein (TBP)F: TTGGTTTCATTAGCTGCACAA
R: ACTGCGGGAGTCAAATCTTC
14953.5Tesovnik et al., 2017
defensin-2F: GCAACTACCGCCTTTACGTC
R: GGGTAACGTGCGACGTTTTA
15955.0Tesovnik et al., 2017
Fig. S1

Protein content of different pollen diets. HD – highly diverse pollen diet, LD – lowly diverse pollen diet.

Fig. S2

Interaction plot for a) pollen consumption and b) daily bee body weight from day 1–5.

Blue line - highly diverse (HD) pollen diet, orange line - lowly diverse (LD) pollen diet.

Table S2

Characteristics of the pollen used to create different pollen diets. The high diversity (HD) pollen diet was created by mixing all 10 pollen types at equal frequency while the low diversity (LD) pollen diet consisted exclusively of pollen type 1.

graphic/j_jas-2022-0003_ingr_001.png

Color codes

1 - Dark yellow; 2 - Dark Yellow; 3 – Orange; 4 - Light Purple; 5 - Dark Purple; 6 – Red; 7 -Dark Grey; 8 - White Brown; 9 - Light Brown; 10 - Grey

DOI: https://doi.org/10.2478/jas-2022-0003 | Journal eISSN: 2299-4831 | Journal ISSN: 1643-4439 (formerly 2299-4831)
Language: English
Page range: 29 - 43
Submitted on: May 25, 2021
Accepted on: Jan 20, 2022
Published on: Jun 22, 2022
Published by: The National Institute of Horticultural Research and Apicultural Research Association
In partnership with: Paradigm Publishing Services

© 2022 Michael N. K. Muturi, Joel L. Bargul, H. Michael G. Lattorff, published by The National Institute of Horticultural Research and Apicultural Research Association
This work is licensed under the Creative Commons Attribution 4.0 License.