Have a personal or library account? Click to login
Evaluating Efficacy of Fumagilin-B® Against Nosemosis and Tracking Seasonal Trends of Nosema spp. in Nova Scotia Honey Bee Colonies Cover

Evaluating Efficacy of Fumagilin-B® Against Nosemosis and Tracking Seasonal Trends of Nosema spp. in Nova Scotia Honey Bee Colonies

Open Access
|Nov 2020

Full Article

INTRODUCTION

Nosemosis is a disease caused by the microsporidia Nosema apis and Nosema ceranae that affects adult honey bees (Apis mellifera). Adult honey bees become infected with nosemosis through the consumption of Nosema spp. spores in contaminated food or water, through trophallaxis or by cleaning (Fries, 2010; Martín-Hernández et al., 2012). These spores then germinate into a vegetative stage in the ventriculus, infecting the epithelial cells within the honey bee midgut (Fries, 2010; Martín-Hernández et al., 2012). This causes various symptoms including a reduction in lifespan, colony strength, brood food production, honey production, poor spring build-up and colony death (Higes et al., 2008; Guzman-Novoa et al., 2010; Higes, Martín-Hernández, & Meana, 2010; Goblirsch et al., 2013). High N. apis levels cause dysentery, and high N. ceranae levels have been known to cause small spring clusters, but these symptoms alone cannot be used to reliably diagnose the presence of Nosema spp. (Higes et al., 2008; Fries, 2010; Stevanovic et al., 2013).

Since the early 2000s, the composition of Nosema spp. has shifted in honey bee colonies from predominantly N. apis to a mixture of N. apis and N. ceranae in many areas (Klee et al., 2007; Paxton et al., 2007; Emsen et al., 2016). In Canada, multiple studies and surveys have found that the majority of Nosema spp. positive honey bee colonies sampled are dominated by N. ceranae infections rather than by N. apis or mixed Nosema spp. infections (Copley et al., 2012; Emsen et al., 2016; Canadian National Bee Health Survey, 2017). To manage Nosema spp. infections, beekeepers in Canada use Fumagilin-B® (originally manufactured by Medivet Pharmaceuticals, High River, Alberta and now manufactured by Can-Vet Animal Health Supplies Ltd., Guelph, Ontario; DIN 02231180), the only commercially available antimicrobial registered to treat nosemosis. In Nova Scotia (NS), 20% of surveyed beekeepers in the Canadian Association of Professional Apiculturists annual survey reported using Fumagilin-B® in a spring treatment and 30% of surveyed beekeepers reported using Fumagilin-B® in an autumn treatment; these were the highest reports of Fumagilin-B® use to manage Nosema spp. across Canada on a percentage beekeeper basis, except for Alberta and Saskatchewan (Ferland, 2019).

Fumagilin-B® has been used for more than five decades to manage Nosema spp. infections, but concerns about resistance (Huang et al., 2013) and short-lived efficacy (Williams et al., 2008) have arisen. Furthermore, as N. ceranae becomes more prevalent in honey bee colonies in some areas (Klee et al., 2007; Paxton et al., 2007; Chen et al., 2008; Copley et al., 2012; Emsen et al., 2016), beekeepers want to know if Fumagilin-B® is still effective against N. ceranae as well as N. apis, and whether the optimal window of treatment is in spring or autumn. The objectives of our project were to evaluate the efficacy of Fumagilin-B® applied at label rate against Nosema spp. in NS honey bee colonies during the spring and autumn and to monitor the seasonal trends (prevalence and abundance) of N. apis and N. ceranae over a thirteen-month period in these same colonies.

MATERIAL AND METHODS
Experimental design

Sampling was carried out from February 2018 to March 2019 in Colchester County and Kings County, Nova Scotia, Canada. Three apiaries of twenty-four colonies each were used for this study, and all colonies were managed according to typical local practices by a commercial beekeeper. Within each apiary, there were two treatment groups (Fumagilin-B® and control) of twelve colonies each (n = 12). Hives used in this study were managed in a double brood chamber and were used for honey and nucleus colony production but not pollination. No hives were moved during this trial. All colonies were headed with Buckfast queens locally bred that were less than two years old. Colonies were divided as necessary to prevent swarming, and honey supers were added accordingly. If colonies became queenless, weak, or died, they were excluded from the study. Colonies were managed as two hives per pallet, and pallets were randomly assigned as either Fumagilin-B® treatment colonies or control colonies. Colonies were wintered in double brood chambers and protected with black plastic wrap.

Sampling

Colonies were sampled once monthly, except during treatment with Fumagilin-B® from February 2018 to March 2019 (Tab. 1). Samples of approximately 150 bees were collected from each colony by the inner cover being lifted and bees collected using a 250 mL measuring cup. We collected older forager and guard bees, as they are more likely to have nosemosis (Meana, Martín-Hernández, & Higes, 2010), and older bees were expected to be directly under the inner cover. Once collected, the bees were placed in a plastic bag, labelled, and placed on ice for transport back to the laboratory, where they were stored in a −20°C freezer until microscopy could occur (Fries et al., 2013).

Table 1

Honey bee sampling schedule and description from February 2018 to March 2019 in Nova Scotia colonies

DateDescription
28 February 2018First sample collection
27 March 2018Regular monthly sample collection
23 April 2018Pre spring treatment
24 & 25 April 2018Spring treatment and feeding (no samples collected)
27 April 20182–3 days post spring treatment
01 May 20185–6 days post spring treatment
07 May 201812–13 days post spring treatment
10 May 201815–16 days post spring treatment
29 May 201834–35 days post spring treatment/Regular monthly sample collection
26 June 2018Regular monthly sample collection
26 July 2018Regular monthly sample collection
29 August 2018Regular monthly sample collection
03 October 2018Pre fall treatment
05 & 06 October 2018Fall treatment and feeding (no samples collected)
10 October 20184–5 days post fall treatment
16 October 201810–11 days post fall treatment
19 October 201813–14 days post fall treatment
29 October 201823–24 days post fall treatment
14 March 2019Final sample collection
Spring Fumagilin-B® Treatment

Colonies in the Fumagilin-B® group of each apiary (n = 12) received a spring dose of Fumagilin-B® mixed in sugar syrup as per label directions (4 L of Fumagilin-B® medicated 1:1 sugar syrup), while the twelve control colonies in each apiary received 4 L of unmedicated 1:1 sugar syrup. Each Fumagilin-B® colony received 100 mg of active ingredient in the spring.

Autumn Fumagilin-B® treatment

Colonies in the Fumagilin-B® group of each apiary (n = 12) received Fumagilin-B® mixed in sugar syrup as per label directions (8 L of Fumagilin-B® medicated 2:1 sugar syrup), while the twelve control colonies in each apiary received 8 L of unmedicated 2:1 sugar syrup (Williams et al., 2011). Each Fumagilin-B® colony received 200 mg of active ingredient in the autumn.

Microscopy

Nosema spp. spores were detected and quantified as per Cantwell (1970) and Human et al. (2013). Thirty bees from each sample were counted and placed in a separate plastic bag, and 30 mL of water were added to this bag (equivalent of 1 mL per bee) (Williams et al., 2011). The contents of the bag were then thoroughly crushed using a rolling pin. Approximately 0.05 mL of the mixed sample was placed in each well of the hemocytometer (Reichert Bright-Line, Improved Neubauer, 0.1 mm depth) and a compound microscope under 400x magnification was used to count spores in five of the twenty-five grid squares (four outside corner grid squares and one centre grid square) in both wells. The total number of spores was recorded. The well average was then multiplied by 50,000 to find the average spore load per bee. Although there is currently no globally recognized agreement on economic thresholds for Nosema spp. (Holt & Grozinger, 2016), the widely used economic treatment threshold of a million spores per bee for N. apis was used for this study, but this threshold has not yet been updated to reflect N. ceranae (Williams et al., 2011).

Once Nosema spp. levels in each sample were quantified (spores/bee), a subset of each bee sample (10 bees per sample) was sent to the National Bee Diagnostic Centre in Beaverlodge, Alberta for identification of Nosema species. Samples were pooled among all three yards to create a composite sample for each treatment group (Fumagilin-B® and control) across seventeen collection periods, for a total of thirty-four pooled samples.

Diagnosis of Nosema species

Nosema spp. identification performed by the National Bee Diagnostic Centre followed protocols developed by Hamiduzzaman, Guzman-Novoa, & Goodwin (2010) and Gisder & Genersch (2013). Species were determined by a conventional polymerase chain reaction (PCR) using a Multiplex Supermix (Qiagen). Positive controls were included in each PCR. Positive controls for N. apis and N. ceranae consisted of PCR product which had been cloned into plasmid using PGEM T-easy vector and JM109 competence cells. The DNA inserts were sent for sequencing to confirm Nosema species. Amplification assays were performed by adding 60 ng of genomic DNA and 0.4 nM of each primer (Tab. 2) in a Veriti thermal cycler (Applied Bioscience Technologies). RPS5 was chosen as a reference housekeeping gene. PCR conditions were five minutes at 95°C for initial denaturation and enzyme activation, followed by thirty-five cycles of one minute at 94°C, one minute at 58°C, one minute at 72°C and a final elongation at 72°C for seven minutes. Amplification products were separated by 1% agarose gel, stained with SYBR Safe (Invitrogen) and visualized under UV and blue-light illumination.

Table 2

List of primers used to identify Nosema species

TargetPrimerSequence (5′–3′)Amplicon size (bp)
RPS5RPS5-FAATTATTTGGTCGCTGGAATTG105
RPS5-RTAACGTCCAGCAGAATGTGGTA
RNA polymeraseNcpol-FTGG GTT CCC TAA ACC TGG TGG TTT662
Ncpol-RTCA CAT GAC CTG GTG CTC CTT CT297
Napol-FAGC AAG AGA CGT TTC TGG TAC CTC A
Napol-RCCT TCA CGA CCA CCC ATG GCA
Statistical analysis

This study was designed as completely randomized. Due to the nature of our count data and individual colony spore values containing many zeros, the model assumptions of normal distribution and constant variance of the residuals could not be met for the original data or through transformation. Therefore, non-parametric Kruskal-Wallis analyses were conducted in Minitab (2018) with the unit of replication being individual colonies. Independence was assumed through randomization. The level of significance was set at 5% (α = 0.05).

RESULTS
Spring Fumagilin-B® treatment

Before the application of the spring Fumagilin-B® treatment on 23 April 2018, there was no significant difference in Nosema spp. spore loads among hives in the control or treatment groups (χ2 = 1.22, df = 1, P = 0.27). Before treatment, control colonies had on average (±SE) 7.4 ± 3.3 * 105 spores per bee while Fumagilin-B® colonies had on average 4.3 ± 2.5 * 105 spores per bee. Fumagilin-B® colonies had significantly fewer Nosema spp. spores than control colonies after treatment (29 May 2018 compared to 23 April 2018) (χ2 = 4.88, df = 1, P = 0.03). By 29 May 2018, Fumagilin-B® colonies had on average 4.7 ± 2.5 * 105 spores per bee while control colonies had on average 10.4 ± 3.3 * 105 spores per bee.

Autumn Fumagilin-B® Treatment

Nosema spp. spore loads between control and Fumagilin-B® colonies did not differ significantly before the application of autumn Fumagilin-B® treatment on 3 October 2018 (χ2 = 0.06, df = 1, P = 0.80). Before treatment, control colonies had on average (±SE) 5 ± 0.5 * 105 spores per bee, while Fumagilin-B® colonies had on average 0.015 ± 0.015 * 105 spores per bee. The treatment did not significantly affect Nosema spp. spore counts in autumn (χ2 = 0.83, df = 1, P = 0.36) (3 October 2018 compared to 29 October 2018). During this period, Fumagilin-B® colonies maintained lower levels of Nosema spp. spores than control colonies, but the difference was not significant. The control colonies had average spore counts of 3.3 ± 1.4 * 105 spores per bee, and treatment colonies had an average spore count of 1.1 ± 0.6 * 105 spores per bee. Neither control colonies nor Fumagilin-B® colonies met or exceeded the economic treatment threshold during the autumn treatment period.

Seasonal Nosema spp. infection trends

The seasonal trend of Nosema spp. infection for our study on control colonies showed fluctuations in Nosema spp. spore levels between 28 February 2018 and 1 May 2018. During this period, Nosema spp. spore levels were below the economic treatment threshold of 1 million spores per bee (Fig. 1). However, we detected a sharp increase in Nosema spp. spore levels as May progressed, reaching a level of 1.7 million spores per bee in control colonies by the end of the month, which was the highest spore count during the study. By the June observation period, Nosema spp. spore levels in control colonies had decreased below the treatment threshold once again and remained at low levels through the summer months (Fig. 1). By October, Nosema spp. spore levels increased again but remained well below the economic treatment threshold. Colonies that were treated with Fumagilin-B® displayed similar trends in spore counts with a few notable exceptions. Fumagilin-B® colonies had similar Nosema spp. spore level trends to control colonies between 28 February 2018 and 23 April 2018. After the application of Fumagilin-B® on 25 April 2018, Nosema spp. spore levels reduced in comparison to control colonies (Fig. 1). The most notable difference between the two treatment groups was observed in May, when colonies treated with Fumagilin-B® maintained Nosema spp. spore loads below 0.5 million spores per bee and never increased above the economic threshold unlike the control colonies. Similar to the control colonies, Nosema spp. spore levels decreased in treated colonies by the end of June and stayed at low levels throughout the summer. Nosema spp. spore levels increased slightly in the autumn by 10 October 2018, but spore levels never reached the economic threshold. By the end of the trial in March 2019, both the Fumagilin-B® and control colonies had low spore counts (Fig. 1).

Fig. 1

Mean Nosema ceranae spore loads (number of spores per bee x 106) ± SE in honey bee colonies in Nova Scotia (n = 72) from February 2018 to March 2019 after spring and autumn applications of Fumagilin-B® following label rate. The first arrow labelled ‘1’ indicates the spring application of Fumagilin-B® to treatment colonies, while the second arrow labelled ‘2’ indicates the autumn application of Fumagilin-B® to treatment colonies. Note: x axis for sampling date is not to scale.

Identification of Nosema species

Of the samples pooled by collection period, 74% (25/34) tested positive for N. ceranae, while 26% (9/34) contained no Nosema spp. spores. No N. apis was detected during the trial.

DISCUSSION

We found that Fumagilin-B® suppressed N. ceranae but does not completely eradicate it, supporting what others have observed (e.g. Williams et al., 2011). Fumagilin-B®'s mode of action against Nosema spp. is the inhibition of the enzyme methionine aminopeptidase2 (MetAP2), which is required for normal cell functioning (Zhang et al., 2006; Huang et al., 2013; Johnson et al., 2013; van den Heever et al., 2016). The inhibition of MetAP2 leads to cell growth arrest (Frottin et al., 2016), meaning that Fumagilin-B® does not kill spores but instead suppresses the reproduction of Nosema spp. spores (Williams et al., 2008; Huang et al., 2013). Although a suppressive effect was not detected for the autumn application, the spore loads in both control colonies and Fumagilin-B® colonies never met the economic treatment threshold to warrant a treatment, and there was no clear trend in Nosema spp. spore levels. Optimal Nosema spp. management for beekeepers may be a single spring application of Fumagilin-B®, but colonies should still be monitored in the autumn. Based on the economic threshold of 1 million spores/bee, feeding Fumagilin-B® as per label directions in the spring can suppress N. ceranae significantly and keep spore levels below the treatment threshold for the spring build-up phase. This requires further investigation however, as it is not known if the current recommended treatment threshold is also applicable to N. ceranae (Williams et al., 2011). Honey bees are in their linear growth phase of development in May in NS, and the rapid growth and expansion of colonies is important in the preparation of the first nectar flow and for commercial crop pollination. If colony growth is impeded during the month of May, beekeepers may have fewer hives available for pollination, and colonies may not produce a significant honey crop. Therefore, managing N. ceranae, particularly during the month of May, gives colonies the opportunity to maximize population growth.

Our results suggest that the Nosema species profile is shifting to be predominantly N. ceranae in NS, and in our test colonies, the species profile has been exclusively N. ceranae, an observation that has been noted elsewhere (Chen et al., 2008; Stevanovic et al., 2013). Nosema apis is considered a spring and autumn disease, and N. ceranae a disease that impacts honey bees throughout the year (Higes, Martín-Hernández, & Meana, 2010; Copley et al., 2012; Martín-Hernández et al., 2012). We found levels of N. ceranae well above the economic threshold in May, decreased levels during the summer months from July to September and increased levels in October. A study conducted in the United States observed a similar trend in which an increased spore load was detected in April and May, followed by a decline in the summer months and a small increase once again in the autumn months (Traver, Williams, & Fell, 2012). Increased Nosema spp. spore levels in both Fumagilin-B® and control colonies in October could be explained by limited flying days for bees to perform cleansing flights or by an autumn infection. Favourable weather conditions allow honey bees to take cleansing flights to defecate outside the hive, potentially removing Nosema spp. spores (Retschnig et al., 2017). Possibly we would have found N. apis in additional beekeeping operations, but by focusing on one commercial operation we were able to reduce variability caused by different management practices and design a more controlled study. Further province-wide testing is needed to better understand if the Nosema spp. profile in NS honey bee colonies has completely shifted to N. ceranae.

We may have detected a decrease in Nosema spp. spore quantity in June, with or without application of Fumagilin-B®, due to the natural life cycle of Nosema spp. (Emsen et al., 2016). In N. apis, there is a seasonal trend of increased spore loads in the spring, followed by a decline in the summer and an increase once again in autumn (Bailey, 1955). However, a clear trend is not always observed with N. ceranae (Fries, 2010; Higes et al., 2013). The seasonal trend of Nosema spp. in colonies in both treatment groups displayed a dramatic spike in spore quantity in May followed by a decrease in June. Spore levels were much lower overall from July to September in both groups.

Determining the seasonal trends and presence of one or both Nosema spp. is important to beekeepers for a number of reasons. When both species are present, synergistic effects may occur. In laboratory experiments, Milbrath et al. (2015) found that honey bees with mixed Nosema spp. infections had higher mortality rates compared to bees with single-species infections, although Williams et al. (2014) found significantly higher honey-bee mortality in sole N. ceranae infections compared to mixed or sole N. apis infections. Furthermore, previous studies have shown higher spore counts in bees infected with N. ceranae compared to bees infected with N. apis (Paxton et al., 2007; Milbrath et al., 2015; Emsen et al., 2016), which suggests that the treatment threshold for N. ceranae needs to be adjusted for Fumagilin-B®. With the Nosema spp. profile shifting to be predominantly N. ceranae, beekeepers must adapt to the characteristics of this species and be prepared to manage it effectively.

Our study provides assurance that Fumagilin-B® suppresses Nosema spp. spores effectively in the spring in NS when applied at the label rate, which may be the optimal management strategy for beekeepers seeking to suppress Nosema spp. spore loads to optimize spring build-up. Even though our data suggest a single spring treatment effectively manages Nosema spp., beekeepers should still monitor their colonies in the autumn. A relatively low proportion of NS beekeepers treat with Fumagilin-B® in the spring (20%) compared to 30% in the autumn (Canadian National Bee Health Survey, 2017), and our results demonstrate that beekeepers should consider a spring treatment to maximize spring build-up. Future research should examine the treatment threshold for N. ceranae to determine if the current threshold of 1 million spores per bee causes economic damage to colonies infected with N. ceranae. Additionally, a broader analysis of colonies in the Maritimes is needed to determine if N. ceranae is dominating the Nosema spp. profile elsewhere.

DOI: https://doi.org/10.2478/jas-2020-0025 | Journal eISSN: 2299-4831 | Journal ISSN: 1643-4439
Language: English
Page range: 277 - 286
Submitted on: Jan 28, 2020
|
Accepted on: Oct 3, 2020
|
Published on: Nov 18, 2020
In partnership with: Paradigm Publishing Services
Publication frequency: 2 issues per year

© 2020 Robyn McCallum, Sawyer Olmstead, Jillian Shaw, Kathleen Glasgow, published by Research Institute of Horticulture
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.