Epidemiology, morphometry, and phylogenetic analysis of Haemonchus contortus in small ruminants of Malakand division, Pakistan

Fig. 1.

The study area map displays the geographical distribution of sampling locations in the Malakand Division of Khyber Pakhtunkhwa, Pakistan. It includes a national context map (country map), a provincial focus map (province map), and detailed district boundaries within the study area, highlighting Dir Upper, Dir Lower, Swat, Malakand, Shangla, and Buner. The map was designed and modified by the authors.

The study was conducted in Malakand division, Khyber Pakhtunkhwa, Pakistan (33° 59’ 59.89” N latitude and 72° 56’ 2.72” E longitude). Malakand Division is renowned for its extensive livestock farming and variety of agricultural activities. The region experiences average annual rainfall of 8.4 inches and temperatures ranging from -1°C in January to 42°C in July (Ali et al., 2021; Irshad et al., 2023).

In total, 878 (Goats: 398 and Sheep: 480) fecal samples were randomly gathered from sheep and goats across four seasons (January to December, 2024) from six districts of Malakand division, Pakistan, using a multistage random sampling design. Every fourth or eighth animal was sampled, depending on the flock size. To avoid repetition, no herd or animal was sampled more than once. Animals aged 3 months or older were included in the study; both healthy and unhealthy animals, regardless of treatment history, were sampled to allow comparative analysis. Pregnant, lactating and severely injured animals were excluded. Samples were collected directly from the rectum of sheep and goats. Comprehensive data encompassed animal category, time, gender, season, region, age, treatment history, dietary system, water source, and health status. Herd-level clustering was considered negligible, and no mixed effects modelling was applied due to the limited number of animals sampled per herd and a one-time visit design. Samples were examined at the Parasitology laboratory, Department of Zoology, University of Malakand, using the direct smear method under a microscope at 4X, 10X, and 40X. The Haemonchus eggs were identified based on the standard keys described by Mussa (2023) and Soulsby (1982).

A total of 100 abomasa (50 goats, 50 sheep) were collected from local abattoirs of the study area and processed immediately in the laboratory. A total of 1200 adult Haemonchus were recovered using the procedures described by Kuchai et al. (2012). The worms were then cleaned in normal saline and washed in phosphate-buffered saline (PBS; pH=7.4) containing ampicillin (100 mg/ml) and cloxacillin (50 mg/ml) to inhibit microbial growth. Subsequently, Haemonchus was identified based on morphological characteristics using the key described by Soulsby (1982). Parasites were stored at -20°C in 70 % glycerin alcohol solution for molecular analysis.

For morphometric characterization, 35 samples of Haemonchus eggs and 126 (76 females and 50 males) samples of adult worms were randomly selected for measurement. Parasitic eggs and adult worm measurements were conducted using a compound microscope (Olympus BX 53, Tokyo, Japan). Body length, body width, esophageal length, spicule length, gubernaculum length, vulva to posterior end distance, and anus to posterior end distance were measured in millimeters. In addition, the egg morphology, including the egg’s length, width, and shape, was evaluated as described by Lichtenfels et al. (1994) and Soulsby (1982).

Genomic DNA was extracted from individual Haemonchus samples using a commercial DNA extraction kit (Qiagen, Hilden, Germany), following the manufacturer’s guidelines.

To amplify the mitochondrial COX-1 gene for phylogenetic analysis, a polymerase chain reaction (PCR) was performed following Kandil et al. (2018). The primer sets used were LCO1490 (5' GGTCAACAAATCATAAAGATATTGG 3') as a forward primer and HCO2198 (5' TAAACTTCAGGGTGACCAAAAAATCA 3') as the reverse primer. Thermocycling conditions: 95°C for 5 minutes, 30 cycles of 95°C for 60 seconds, 55°C for 45 seconds, 72°C for 45 seconds, and a final extension at 72°C for 7 minutes. The amplified Cox-1 gene PCR products were visualized through agarose gel electrophoresis, as described by Ndosi et al. (2023).

The amplicons were confirmed through gel electrophoresis. Two amplified DNA products (one each from goats and sheep samples) were randomly selected, purified, and sequenced at Macrogen Inc. in Seoul, South Korea. The sequences were assembled and aligned using ClustalW multiple alignment implemented in MEGA11. Sequence analysis was performed using BLASTn algorithms and databases from the National Center for Biotechnology Information (NCBI) database. A phylogenetic tree was constructed using a neighbor-joining method implemented in MEGA 11.

Data were analyzed using SPSS 20 and GraphPad Prism V.7.0. Correlation between risk factors and Haemonchus prevalence was assessed through bivariate analysis using Chi-square tests. Descriptive statistics (standard deviation, error, and variance) were calculated. A p-value < 0.05 indicated statistical significance.

During the study period from January to December (2024), 878 fecal samples (Goats: 398 and Sheep: 480) were collected randomly from goats and sheep across six districts of the Malakand Division, namely (Swat, Shangla, Dir L, Dir U, Buner, and Malakand). Two hundred twenty-one (221) small ruminants tested positive for Haemonchus, resulting in an observed total prevalence of Haemonchus of 25.17 %. Sheep had a slightly greater prevalence of haemonchosis (26.04 %) than goats (24.12 %), although the difference was not statistically significant (p > 0.05) (Table 2).

In the current study, female sheep exhibited a higher prevalence of Haemonchus (27.86 %) compared to male sheep (23.5 %), as well as female goats (25.22 %) and male goats (22.62 %). However, this difference was not statistically significant (p>0.05).

Goats and sheep were categorized into three age groups: less than 1 year, 1 to 5 years, and greater than 5 years. Haemonchus infection rates varied significantly by age group (p < 0.05). Specifically: Younger animals (<1 year) had the highest infection rates, with 29.25 % in goats and 27.13 % in sheep, followed by older animals (>5 years) years Sheep 28.82 % and goats 27.03 % while animals aged (1 – 5) years had the lowest infection rates: 17.36 % in goats and 22.65 % in sheep.

This study was conducted across six districts of the Malakand division: Swat, Shangla, Dir (L), Dir (U), Malakand, and Buner. The prevalence of haemonchosis varied across districts, with Swat (26.22 %), Shangla (24.44 %), Dir (L) (26.28 %), Dir (U) (23.08 %), Malakand (26.25 %), and Buner (24.06 %). However, these differences were not statistically significant (p>0.05). Furthermore, the prevalence of haemonchosis was highest in grazing sheep (27.84 %) and goats (26.19 %) compared to stall-fed sheep (24 %) and goats (21.81 %), though the difference was not statistically significant (p>0.05).

Concerning health status, a statistically significant variation (p<0.05) was observed; the highest prevalence of haemonchosis was observed in poor goats (36.73 %) and sheep (35.71 %), followed by moderate sheep (30.11 %) and goats (26.97 %). The lowest prevalence rate was found in healthy goats (18.78 %) and sheep (20.59 %).

In addition, a high degree of Haemonchosis was observed in open water drinking goats (28.46 %) and sheep (28.39 %), followed by stream water sources drinking sheep (28.93 %) and goats (25.56 %) compared to other water sources like tap and bore water, the difference was not statistically significant (p>0.05). The prevalence of Haemonchosis in goats and sheep was further evaluated in different seasons. The highest prevalence was found in summer (27.69 %), while the lowest prevalence was recorded in winter (22.11 %), though this difference was not statistically significant (p>0.05).

Furthermore, statistically significant (p<0.05) variations between treated and untreated small ruminants were observed. The highest infestation was observed in untreated sheep (29.79 %) and goats (28.19 %), while the lowest prevalence was found in treated goats (16.55 %) and sheep (17.88 %), Table 3.

The present study randomly selected 35 positive samples from different small ruminants for egg morphometric characterization. Haemonchus eggs were oval, with equal poles and divided cells that did not fill the egg cavity (Fig. 2A). The average length of the eggs was 80.98μm, ranging from 63μm to 99μm. Egg width ranged from 36μ to 61μ, with an average width of 45.04μ. (Table 4).

Fig. 2.

Morphological features of Haemonchus contortus.

(A). Egg containing morula, showing measured length and width (μm); (B). Male bursa highlighting spicules and caudal rays, with spicule length (mm); (C). Adult male and Female H. contortus aligned on a calibrated scale to show total body length (mm); (D). Posterior end of female showing anus and measured tail length (mm); (E). Vulvar flap of female Haemonchus; (F). Cervical papillae with recorded length (mm); (G). Oesophagus of H. contortus showing total length (mm)

A total of 1200 Haemonchus worms were recovered from 100 abomasums collected from the different abattoirs of the study area. One hundred twenty-six worms (76 females and 50 males) were randomly selected (from goats and sheep) for morphometric analysis. The results are summarized in Table 5. The anterior end was broad and blunt, with a small buccal cavity featuring a visible tooth protruding from the dorsal wall. The cervical papillae of both male and female worms possessed a spine-like protrusion on its outside that ran almost parallel to the longitudinal cuticular ridges. The body also had transverse striations, which were visible.

Male worms were smaller than females, measuring 11.9 to 13.8 mm in length and 0.23 to 0.38 mm in width (Fig. 2C). The cervical papillae ranged from 0.28 to 0.38 mm, whereas the esophagus measured 0.61 to 0.92 mm. A bursa with two large lateral lobes and a small dorsal lobe was observed at the tail (Fig. 2B). The asymmetrically branched dorsal ray divided near the tip, creating a short external branch. Two 0.44 to 0.78 mm long spicules with a bulb and pore toward the end were supported by a spindle-shaped gubernaculum tapered toward the tail end and measured 0.09 to 0.18 mm.

The length of female Haemonchus measured 15 – 23.8 mm while the width was 0.29 – 0.38 mm (Fig. 2C). The cervical papillae measured 0.24 – 0.42 mm (Fig. 2F), while the esophagus was lengthy and club-shaped, measuring 0.72 – 1.22 mm (Fig. 2G). Female Haemonchus has a slender, spineless, straight, and pointed tail. The characteristic ‘barber pole’ appearance, resulting from the coiled uterus and intestines, was observed. The vulva is located in the posterior portion of the body, approximately 0.68 – 0.82 mm from the tail end, and is covered by a large vulvar flap (Fig. 2E). The anus is located 0.29 – 0.35 mm from the posterior end (Fig. 4D).

Following DNA extraction and COX-1 gene amplification, the PCR products of two Haemonchus isolates from Malakand Division were examined under UV light, producing an amplicon of approximately 666 bp (Fig. 3). The Neighbor-Joining method was utilized to construct a phylogenetic tree comparing the two isolates from the current study with 19 published sequences from various regions, including Pakistan, Bangladesh, Iran, Brazil, USA, New Zealand, Australia, and the UK, as well as out-group nematode species.

Fig. 3.

Agarose gel electrophoresis showing PCR amplification of COX region of H. contortus.

Phylogenetic analysis revealed two distinct haplotypes in the present study isolates. One isolate (5047657) was grouped with isolates from Pakistan (724353), Bangladesh (LC716224), and Iran (MW051258), suggesting genetic similarity with the isolates from neighboring regions. The other isolate (5047660) formed a separate haplotype (Fig. 4). These findings indicate the presence of two distinct genetic variants of Haemonchus, which may reflect intraspecies variation or localized adaptation within Haemonchus populations in the Malakand division.

Fig. 4.

Phylogenetic tree of H. contortus in Goats and Sheep using Cox-1 marker. The constructed tree illustrates the genetic links between the isolates of the current study and reference sequences from other areas. Bootstrap values are given at branch points representing the group’s confidence levels.

The primary limitation of this study was time constraints, which resulted in restricted sampling across districts and limited sequencing for genetic diversity analysis. Future studies should focus on expanding sampling and sequencing efforts to understand better the genetic diversity of Haemonchus in the area.