Description of Pseudobenedeniella johnstoni sp. n. (Monogenea: Capsalidae) from the gills of Antarctic black rockcod, Notothenia coriiceps Richardson in coastal waters of West Antarctica

N. Y. Rubtsova; A. Chaudhary; S. Glotov; T. A. Kuzmina

doi:10.2478/helm-2024-0037

Figures & Tables

a – The anatomy of an adult specimen of Pseudobenedeniella johnstoni sp. n. in ventral view: ah, anterior hamulus; ag, accessory gland; ap, adhesive pad; as, accessory sclerite; co, common genital opening; e, eye; eg, egg; g, germarium; gt, Goto glands; ha, haptor; m, mouth; mr, muscular rim of haptor; ot, ootype; ph, pharynx; pe, penis; ph, posterior hamulus; s, muscular sucker; t, testis; u, uterus, v, vitellarium; va, vagina; vd, vitelline duct; vl, marginal valve; vr, vitelline reservoir; vs, vas deferens. Scale bar: 1 mm. b – Sclerotized structures of haptor of Pseudobenedeniella johnstoni sp. n.: mh, marginal hooklet (scale bar 0.02 mm); ah, anterior hamulus, ph, posterior hamulus (scale bar 0.1 mm); as, accessory sclerites (variations of shape), scale bar 0.07 mm. c – Schematic drawing of clamp-shaped haptor of Pseudobenedeniella johnstoni sp. n.: s, septum; o, opening of haptor; vl, marginal valve.

Fig 2.

a – Microscopic image of carmine-stained adult of Pseudobenedeniella johnstoni sp. n. Scale bar: 1 mm. b – Haptor of Pseudobenedeniella johnstoni sp. n. showed in profile. Note peduncle (arrow). c – Haptor of Pseudobenedeniella johnstoni sp. n. showed in its closed state. d – Juvenile specimen of Pseudobenedeniella johnstoni sp. n.

Fig. 3.

a – Flattened haptor of Pseudobenedeniella johnstoni sp. n. with well-seen sclerotized structures in profile (ah, anterior hamulus; as, accessory sclerite; ph, posterior hamulus), close view. Scale bar 0.1 mm. b – Marginal hooklet of Pseudobenedeniella johnstoni sp. n. (arrow). Inset: close view. Scale bar 0.02 mm.

a – Schematic drawing of the reproductive system of Pseudobenedeniella johnstoni sp. n.: ag, accessory gland; co, common genital opening; ch, germarium chamber; eg, egg; g, germarium; ot, ootype; p, penis; va, vagina; vd, vitelline duct; vr, vitelline reservoir; vs, vas deferens; t, testis; u, uterus. Insets: variation of eggs (eg); vagina (va). b – Modified drawing of the reproductive system of Pseudobenedeniella branchialis from Timofeeva et al. (1987). c – Comparative drawings of silhouettes of anterior hamuli (AH) and posterior hamuli (PH) of Pseudobenedeniella johnstoni sp. n. (j) and Pseudobenedeniella branchialis (br) [modified from Timofeeva et al. (1987)].

Phylogenetic tree based on the 18S sequence data showing the relationships of Pseudobenedeniella johnstoni sp. n. Bootstrap values and Bayesian posterior probabilities shown next to the nodes as ML/BI. Bootstrap support values >70 for ML and >0.70 for Bayesian posterior probabilities are shown. Species sequenced in this study are in bold, and the GenBank accession numbers are listed along with the species names. Scale bars represent the branch length. Families are indicated on the right side.

A phylogenetic tree of capsalid taxa produced from maximum likelihood and Bayesian inference analyses of the 28S nuclear sequence data for the Capsalidae with outgroup taxa. ML bootstrap and PP values are indicated with each node as ML/BI. Species in the red box are sequenced during the present study.

A phylogenetic tree was constructed using data from 28S rDNA sequences of Pseudobenedeniella johnstoni sp. n. and other monogeneans. Values shown at the nodes indicate posterior probabilities from ML analysis (>70) and BI posterior probabilities (>0.70). GenBank accession numbers precede species names. The scale bar indicates the expected number of substitutions per site. Species sequenced in the current study are shown in bold. Families are displayed on the right side.

Information on the capsalid monogenean species used for phylogenetic analysis based on the 18S and 28S gene sequences_

Species	Host	Origin	GenBank accession No.	References
18S gene
Capsala martinieri	Mola mola	UK	AJ276423	Littlewood & Olson, 2001
Neobenedenia melleni	Lutjanus sp.	Malaysia	KU843502, KU843503, KU843504	Ravi &Yahaya, 2016
Benedenia epinepheli	Epinephelus sp.	Vietnam	EU707802	Dang et al., 2011*
Benedenia sp.	Perciform teleost	UK	AJ228774	Littlewood & Olson, 2001
Benedenia humboldti	Seriola lalandi	USA	MW575871	Baeza & González, 2021
Allobenedenia epinepheli	Epinephelus sp.	Vietnam	EU707800	Dang et al., 2011*
Neobenedenia melleni	Epinephelus sp.	Vietnam	EU707804	Dang et al., 2011*
Neobenedenia girellae	Trachinotus blochii	South Korea	MT542140	Nam et al., 2020*
Encotyllabe chironemi	Chironemus marmoratus	UK	AJ228780	Littlewood & Olson, 2001
Pseudobenedeniella johnstoni sp. n.	Notothenia coriiceps	West Antarctica	PP430573, PP430574, PP430575, PP430576	Present study
Pseudobenedenia coriicepsi	Notothenia coriiceps	West Antarctica	OR289962, OR289963, OQ803310, Q803312	Rubtsova et al., 2023
Benedenia sp.	Dasyatis pastinaca	Turkey	MK106094	Turgay, 2018*

28S gene
Neobenedenia sp.	Larimichthys polyactis	South Korea	OM333244	Seo, 2022*
Neobenedenia girellae	Rachycentron canadum	Australia	MW690094	Brazenor et al., 2018
Neobenedenia girellae	Lates calcarifer	Australia	MH843708	Brazenor et al., 2018
Neobenedenia girellae	Trachinotus blochii	South Korea	MT549677	Nam et al., 2020*
Neobenedenia melleni	Epinephelus sp.	Vietnam	EU707805	Dang et al., 2011*
Neobenedenia sp.	Seriola rivoliana	Ecuador	MK202451	Sepúlveda & González, 2019
Neobenedenia melleni	Seriola dumerili	China	JN797596	Ding et al., 2011*
Neobenedenia sp.	Paralabrax humeralis	Chile	MK202450	Sepúlveda & González, 2019
Neobenedenia sp.	Cheilodactylus variegatus	Chile	MT982168	Taborda et al., 2023
Neobenedenia sp.	Aplodactylus punctatus	Chile	MK202438	Sepúlveda & González, 2019
Neobenedenia sp.	Anisotremus scapularis	Chile	MK202439	Sepúlveda & González, 2019
Neobenedenia sp.	Sphoeroides annulatus	Mexico	AY486150	Whittington et al., 2004
Allobenedenia dischizosepta	Acanthistius patachonicus	Argentina	MH929436	Bagnato et al., 2022
Allobenedenia epinepheli	Epinephelus sp.	Vietnam	EU707801	Dang et al., 2011*
Benedenia sciaenae	Argyrosomus japonicus	Australia	FJ971970	Perkins et al., 2009
Encotyllabe chironemi	Chironemus marmoratus	Australia	AF382054	Olson & Littlewood, 2002
Benedenia sekii	Chrysophrys auratus	Australia	FJ971971	Perkins et al., 2009
Benedenia lutjani	Gracilobenedenia lutjani	Japan	AY033939	Whittington et al., 2001
Benedenia rohdei	Seriola quinqueradiata	Japan	AY033940	Whittington et al., 2001
Benedenia seriolae	Seriola quinqueradiata	Japan	KC768341	Sepúlveda & González, 2019
Benedenia humboldti	Seriola lalandi	USA	MW575871	Baeza & González, 2021
Benedenia epinepheli	Epinephelus sp.	Vietnam	EU707803	Dang et al., 2011*
Benedenia sargocentron	Sargocentron spiniferum	China	JN797597	Ding et al., 2011*
Neoentobdella natans	Pastinachus sephen	Australia	FJ972009	Perkins et al., 2009
Entobdella stenolepis	Hippoglossus stenolepis	Canada	FJ971991	Perkins et al., 2009
Entobdella hippoglossi	Hippoglossus hippoglossus	UK	AY486151	Whittington et al., 2004
Capsaloides cristatus	NA	China	JN711434	Yang, 2011*
Nasicola klawei	Thunnus albacares	USA	HQ721186	Bullard et al., 2011
Capsala martinieri	Mola mola	UK	AF382053	Olson & Littlewood, 2002
Capsala laevis	Istiophorus platypterus	China	JN980396, JN980397	Yang & Hu, 2011*
Pseudobenedeniella johnstoni sp. n.	Notothenia coriiceps	West Antarctica	PP430577, PP430578, PP430579, PP430580	Present study
Pseudobenedenia coriicepsi	Notothenia coriiceps	West Antarctica	OR295461, OR295462, OQ820944, OQ820945	Rubtsova et al., 2023
Neoentobdella taiwanensis	Taeniura meyeni	Taiwan	FJ972010	Perkins et al., 2009

Primers used for PCR and sequencing

Primer	Sequence (5′–3′)	Source
18S rDNA
WormA
1270R	GCGAATGGCTCATTAAATCAG	Littlewood & Olson, 2001
930F	GCATGGAATAATGGAATAGG	Littlewood &Olson, 2001
WormB	CTTGTTACGACTTTTACTTCC	Littlewood &Olson, 2001
28S rDNA
Ancy55F	GAGATTAGCCCATCACCGAAG	Littlewood &Olson, 2001
Ancy1200R	CACCATCTTTCGGGTCTCAACC	Plaisance et al., 2005
L300F	CAAGTACCGTGAGGGAAAGTTG	Plaisance et al., 2005
ECD2	CCTTGGTCCGTGTTTCAAGACGGG	Littlewood et al., 2000

Morphometric characteristics of two species of Pseudobenedeniella from nototheniid fish in two localities_

Host	Notothenia rossi	Notothenia coriiceps
Parasite	Pseudobenedeniella branchialis (Timofeeva et al., 1987)	Pseudobenedeniella johnstoni sp. n.
Authority	Timofeeva et al. (1987)	Present study
Sample size	15	27
Location	gills	gills
Type locality	South Georgia Island (54°30′28″S, 36°34′32″W)*	Galindez Island (65°15′S, 64°16′W)

Body length	4.7 – 8.1 (6.3 ± 0.3)	3.85 – 6.75 (5.54 ± 0.71)
Body width	1.8 – 2.6 (2.2 ± 0.1)	1.3 – 3.0 (2.17 ± 0.39)
Haptor diameter	1.4 – 2.0 (1.7 ± 0.07)	0.93 – 2.25 (1.8 ± 0.32)
Body width to haptor diameter ratio	1.29 – 1.37	1.17
Accessory sclerite length	0.04 – 0.10 (0.07 ± 0.010)	0.05 – 0.13 (0.07 ± 0.01)
Anterior hamulus length	0.29 – 0.35 (0.32 ± 0.01)	0.23 – 0.47 (0.33 ± 0.041)
Anterior hamulus shape	Cylindroid shaft, sharply recurved blade (according to Fig. 3 in Timofeeva et al. (1987), “without pronounced blade” ^**	Widen (wing-like) shaft, serrated on one side, curved sickle-shaped with pronounced blade
Posterior hamulus length	0.15 – 0.22 (0.18 ± 0.01)	0.07 – 0.24 (0.18 ± 0.03)
Posterior hamulus shape	Short and cylindroid shaft, no serrations	Short and broad shaft, serrated distally
Haptor marginal valve width	0.15 – 0.18 (0.16 ± 0.01)	0.09 – 0.14 (0.12 ± 0.01)
Sucker diameter/width × length	0.35 – 0.60 (0.43 ± 0.02)	0.25 – 0.88 (0.63 ± 0.12) × 0.31 – 1.00 (0.53 ± 0.13)
Pharynx length × width	0.46 – 0.67 (0.57 ± 0.02) × 0.64 – 0.81 (0.70 ± 0.02)	0.23 – 0.75 (0.47 ± 0.09) × 0.36 – 0.95 (0.65 ± 0.14)
Germarium length × width	0.37 – 0.51 (0.43 ± 0.02) × 0.37 – 0.59 (0.48 ± 0.02)	0.23 – 0.58 (0.43 ± 0.08) × 0.36 – 0.57 (0.52 ± 0.07)
Testis length × width	0.85 – 1.37 (1.03 ± 0.04) × 0.42 – 0.77 (0.66 ± 0.03)	0.62 – 1.20 (0.96 ± 0.12 × 0.40 – 0.83 (0.59 ± 0.07)
Penis length × width	0.48 – 0.71 (0.59 ± 0.03 × 0.20 – 0.30 (0.24 ± 0.02)	0.46 – 1.43 (0.73 ± 0.12) × 0.16 – 0.62 (0.31 ± 0.05)
Penis shape	“Bottle-shaped”**	Pear-shaped
Egg length × diameter	0.18 – 0.21 (0.19 ± 0.01)×0.09 – 0.14 (0.12 ± 0.01)	0.16 – 0.28 (0.22 ± 0.02)×0.09 – 0.16 (0.13 ± 0.02)
Egg shape	“Tetrahedral shaped”^, both egg ends of same shape, one end has long coiled filament**	Ovoid, more pointed anterior pole, posterior pole blunt with long coiled filament
Vagina outer diameter	0.22^***	0.14 – 0.25 (0.17 ± 0.04)
Vagina inner diameter	0.11^***	0.05 – 0.12 (0.08 ± 0.02)
Vagina shape	“Short, opens near vitelline reservoir”^**	Has wide outer muscular part, and narrow inner part, possibly sclerotized

The percent weights of phosphorus (P), sulfur (S), and calcium (Ca) in the attachment body parts of Pseudobenedeniella johnstoni sp_ n_ and Pseudobenedenia coriicepsi from Antarctic rockcod Notothenia coriiceps from the coastal waters of Galindez Island, West Antarctica obtained by the EDXA

	Pseudobenedeniella johnstoni sp. n. Present study			Pseudobenedenia coriicepsi (from Rubtsova et al., 2023)

Location on fish body	gills			skin

Element, %	P	S	Ca	P	S	Ca
Anterior body end	0.87	1.54	1.59	0.25	0	1.45
Haptor	0	0.51	1.12	0	1.3	2.38
Anterior hamulus edge	0.04	8.06	1.54	0.01	0.01	0.67
Anterior hamulus center	0	3.97	0.68	0.44	8.83	1.95

Description of Pseudobenedeniella johnstoni sp. n. (Monogenea: Capsalidae) from the gills of Antarctic black rockcod, Notothenia coriiceps Richardson in coastal waters of West Antarctica

Figures & Tables

Fig. 1.

Fig 2.

Fig. 3.

Fig. 4.

Fig 5.

Fig. 6.

Fig. 7.

Information on the capsalid monogenean species used for phylogenetic analysis based on the 18S and 28S gene sequences_

Primers used for PCR and sequencing

Morphometric characteristics of two species of Pseudobenedeniella from nototheniid fish in two localities_

The percent weights of phosphorus (P), sulfur (S), and calcium (Ca) in the attachment body parts of Pseudobenedeniella johnstoni sp_ n_ and Pseudobenedenia coriicepsi from Antarctic rockcod Notothenia coriiceps from the coastal waters of Galindez Island, West Antarctica obtained by the EDXA

Paradigm

My account