Skip to main content
Have a personal or library account? Click to login
A contribution on first report of morphogenetic characterization of Anisakis typica parasitizing Indian sand whiting, Sillago sihama from Central west coast of India Cover

A contribution on first report of morphogenetic characterization of Anisakis typica parasitizing Indian sand whiting, Sillago sihama from Central west coast of India

By: ,   and    
Open Access
|Dec 2024

Full Article

Introduction

The molecular evidence of larvae of Anisakis typica being zoonotic agents is missing in the International literature (Leuckart, 1876; Van Thiel, 1960; Van Thiel et al., 1962; World Health Organization, 2004). The worms of genus Anisakis (Anisakidae, Ascaridoidea) have been reported to cause anisakiasis, an inflammation of the human gastrointestinal tract, in many countries (Smith & Wootten, 1978; Nieuwenhuizen et al., 2013; Baird et al., 2014, Shamsi & Barton, 2023; Rahamati et al., 2020). The world-wide occurrence of A. typica and its larvae have, however, been concluded by various authors (Della-Morte et al., 2023; Bao et al., 2015, 2022; Shamsi, 2021; Arizono et al., 2012; Borges et al., 2012). But there are no reports on A. typica or larvae of Anisakis from fish in Indian waters, though certain reports on infections by other anisakid worms from India, viz. Hysterothylacium in different marine fishes appeared in nineties (Rajyalaxmi, 1992; Rajyalaxmi et al., 1991, 1992). The infestations by the agents of anisakiasis from the fish along Indian coast of Bay of Bengal have been scarcely explored. In the study area, the parasite life cycle starts with adult nematodes occurring in the stomach of marine mammals such as cetaceans (Nieuwenhuizen & Lopata, 2013; Pampiglione et al., 2002). Non-embryonated eggs pass with faecal material into the waters of Arabian Sea.)

These nematodes by the latter authors were characterized morphometrically by a dorsal tooth atop cephalic complex. Their differentiation from the reported roundworms from adjacent regions of Indonesia (Suryani et al., 2021), Thailand (Chaiphongpachara et al., 2022), Java, Japan (Suzuki et al., 2021) and Australia (Shamsi, 2021; Yann, 2006) have been substantiated by morphogenetic characterization based on the analysis of sequences of ITS1, ITS2 and 18S rDNA in this investigation. Stray reports have appeared during previous years to account for the seasonal prevalence of Anisakis spp. From different areas of the country, but without any specific diagnostic characteristics of microphotographs or SEM pictures on record to confirm their ‘generic’ as well as ‘species’ status.

Several earlier workers who attempted to review occurrence of Anisakis sp. in Indian subcontinent did not deal with morphotaxonomic aspects of the worms collected. The genetic compatibility of larva of A. simplex with its host Carassius gibelio was worked out by Ahmed et al. (2022) but no reference to the morphotaxonomy of A. typica was discussed. It was confirmed in the study by Ahmed et al. (2022) that larva of Anisakis simplex has not been parasitic in C. gibelio. A. simplex is a well known parasite of carp fish, although it has yet not been reported in C. gibelio. Ahmed et al. (2022).

The authors have admittedly emphasized themselves that A. simplex is a well known parasite of carp fish, although it is still not reported in C. gibelio in India.

The report of one larval nematode species of genus Anisakis sp. L3 larvae in C. batrachus was included in Tripura Report by Koiri and Roy (2016). But no diagnostic features were outlined to confirm its species status. Such half-baked reports on Pre-Monsoon, Monsoon and Post-Monsoon data on a “so-called” species which is not established by appropriate publication of morphological data worth the name of a Figure, must not be taken up as A. simplex larvae from C. batrachus. Virtually no name of any nematode discovered was mentioned in Guchhait et al., (2018). Ruchi and Patricia (2023) included unpublished record of a paper that was purportedly published in International Journal of Zoological Investigations. These were named as 3rd stage larva “Type of A. simplex” without a description or diagnostic characteristics outlined. In addition, as many as eleven species of anisakids, particularly Hysterothylacium were reported by Rajyalakshmi and co-workers, but none recorded anisakiasis with A. typica or its larvae: Rajyalakshmi (2005), Lakshmi (1993), Lakshmi et al., (1993a,b).

Materials and Methods

Study area

The expeditions to collection sites for coastal fish were conducted at Jetty at Porvorim, Panjim, North Goa at 15.505082°N, 73.834789°E for latitude and longitude, respectively, 19Kms away from the recently discovered coral reef-associated ‘Grande’ Island by Indian Scientists on March 5, 2024. Site map of recently discovered Grande Island is given as Figure1.

Fig. 1.

Site map of recently discovered Grande Island.

Collection of A. typica from the examined fish

The study comprised examination of 49 Sillago sihama and 42 Johnius dussumieri. The freshly caught fish in the coastal region were brought to the laboratory. The fish were euthanized by hitting in the region of the spinal cord, with a heavy, sharp object in the fastest manner to avoid unnecessary torment. All fish appeared to be healthy by the criteria that they were able to swim and breathe normally, without gasping for air, eating and interacting with other co-habitants. The body parts, pyloric ceca, liver, alimentary canal, gall bladder and gills were examined for parasites, particularly nematodes. The small intestine of S. sihama yielded 3rd stage larvae (N= 367), which were diagnosed to belong to genus Anisakis, and 8 worms of another agent of anisakiasis, larval R. capoori. The nematodes were killed in lukewarm water; washed thoroughly in 0.85 % normal saline, and fixed in Berland’s solution. A small piece of the mid-body of each of the three individual nematodes were removed with a scalpel, and preserved in 100 % ethanol for molecular analysis. The morphometric analysis conducted on roundworms of S. sihama revealed 6.84 % worms of A. typica and 13.65 % of co-occurring R. capoori in the same fish during 2021 – 2024.

The nematodes were freshly washed with warm water; kept in normal saline during the period of their extraction from the body of their hosts, and processed immediately following the method of Malhotra (1986). Micrographs were taken with the help of BIOVIS Image Analyzer, and camera lucida illustrations were prepared. Specimens were observed in varied magnifications under Nikon Trinocular Research Microscope.

18 worms to be used for Scanning Electron Micrographic analysis were fixed in Glutaraldehyde (2.5 % in 0.1M phosphate buffer), and processed after rehydration (Malhotra et al., 2012). SEM analysis was performed on Jeol JSM 6510LV at the University Sophisticated Instrument Facility (USIF), Aligarh Muslim University, Aligarh, India.

Molecular analyses

The total genomic DNA was isolated from the nematode samples collected from S. sihama by using Qiagen DNeasy Blood and Tissue Kit (Qiagen,USA), following manufacturer’s instructions. The sequences were searched for homology on the DNA databases by using BLAST (Basic Local Alignment Search Tool) (Altschul et al., 1990) on the NCBI GenBank. The sequences were aligned with the sequences of reference organisms derived from databases (www.ncbi.nlm.nih.gov/). The DNA sequences were aligned for phylogenetic analysis using the CLUSTAL W computer program (Thompson et al., 1997), and DNA sequences were edited in DNASTAR (Frontiers in Bioscience; DNAStar, Inc, USA). The evolutionary distances were computed by Kimura’s two parameter method (Kimura, 1980). The phylogenetic tree was constructed by the neighbor-joining method (Saitou & Nei, 1987) using MEGA version 4.0 (Tamura et al., 2011). The tree was evaluated using the bootstrap test (Felsenstein, 1985) based on 1,000 replications. The nucleotide sequences determined in this study were deposited in the National Center for Biotechnology Information (NCBI) under the accession numbers KF636791-18S, KF633459-ITS1 and KF633462-ITS2. PCR was used to amplify the 18S rDNA regions using primer sets Nem18SF, 5′ CGCGAATRGCTCATTACAACAGC-3′ (forward); and Nem18SR, 50-GGGCGGTATCTGATCGCC-3′ (reverse) (Floyd et al., 2005). The primers utilized in the study were designed as according to Malhotra et al. (2012). The rDNA regions comprising ITS1 and ITS2 sequences were amplified with primers, 18SF (5′TTGATTAGGTCCCTGCCCTTT3′) and 26SR (5′TTTCACTCGCCGTTACTAAGG3′) for ITS1 gene, and SS2,(5′TTGCAGACACATTGAGCACT3′) and NC2,(5′TTAGTTTCTTTTCCGCT3′) for ITS2 gene. Each PCR reaction was performed under the following conditions: after initial denaturation at 94°C for 5 min., 35 cycles of 94°C for 30 s (denaturation), 50°C for 30 sec (annealing), 72°C for 30 s (extension), followed by a final extension at 72°C for 8 min. The PCR products were run on a 1 % agarose gel and visualized by Ethidium bromide staining. Purification and sequencing was done by Macrogen, Italy. The information about identified/verified names of submitted sequences has been given to GenBank. Adult nematodes were identified to species based on the available keys and descriptions (Hodda, 2022; Liang et al., 2016; De Ley and Blaxter, 2002; Coomans, 2002; Bruce and Cannon, 1990).

Ethical Approval and/or Informed Consent

No procedures performed in studies involved human participants and the ethical standards of the institutional ethical committee and with the 1964 Helsinki declaration and its later amendments, were followed.

Results and Discussion

The specimens of 3rd stage larvae of Anisakis used in the present investigation were compared morphometrically (Table 1) to reveal that the size of mucron in the specimens of A. typica of authors and co-workers was smallest A. simplex reported by Larizza and Vovlas (1995) (Table 2); than A. physeteris recorded by Pardo-Gandarillas et al. (2009); than A. pegreffii recorded by Roca-Geronesa et al. (2020); and then A. simplex, as reported by Roca-Geronesa et al. (2020). However, the larger length of mucron was encountered in the specimens of A. typica than A. simplex measured by Hurst (1984); than A. physeteris recorded by Pardo-Gandarillas et al. (2009); than A. pegreffii reported by Roca-Geronesa et al. (2020); and then A. simplex as measured by Roca-Geronesa et al. (2020). On the other hand, the measurements of the body of worms, as well as size of oesophagus, and ventriculus of the specimens of A. typica of authors were smaller than those reported by Hurst (1984), Larizza and Vovlas (1995), Quizon et al. (2008), Setyobudi et al. (2011), Abou-Rahma et al. (2016), Roca-Geronesa et al. (2020); Hien et al. (2021), and Mostafa (2023) for A. simplex, while the body size, as well as size of oesophagus and ventriculus of A. pegreffii by Quizon et al. (2008), and by Roca-Geronesa et al. (2020) was larger than the specimens of A. typica of authors. Simultaneously, the size of oesophagus and ventriculus were smaller in A. physeteris than A. typica of the authors and co-workers given in Tables 1 and 2.

Table 1.

Morphometric measurements of 3rd stage larvae of Anisakis typica collected from the Northern whiting, Sillago sihama in the present study.

CharactersMeasurements (mm)
MaleFemale
BodyL:3.89–5.366 (4.98±0.28)8.49–9.82 (7.57±2.79)
BodyW:0.036–0.043(0.039±0.01)0.18–0.37(0.27±0.009)
Buccal toothL:0.0054–0.0072(0.0063±0.004)0.009–0.012(0.010±0.003)
Head
  • L:

  • W:

  • 0.0043–0.0068 (0.0055±0.001)

  • 0.012–0.014(0.013±0.004)

  • 0.010–0.014(0.012±0.006)

  • 0.019–0.022(0.020±0.004)

Buccal cavityDeep:0.016–0.019(0.018±0.002)0.018–0.020(0.19±0.004)
W:0.014–0.018(0.016±0.009)0.016–0.019(0.017±0.003)
Oesophagusi. Anterior0.25–0.27(0.26±0.06)0.27–0.32(0.29±0.08)
0.036-0.043(0.039±0.002)0.041–0.052(0.046±0.02)
ii.Posterior0.18–0.19(0.18±0.007) x 0.054–0.064 (0.059±0.006)0.21–0.25(0.23±0.1) x 0.060–0.064 (0.062±0.01)
IntestineW:0.28–0.609 (0.57±0.08) x 0.065–0.099 (0.087±0.03)
Intestinal caecum
  • L:

  • W:

  • 0.21–0.23(0.22±0.08)

  • 0.0072–0.010(0.009±0.001)

  • 0.28–0.31(0.29±0.08)

  • 0.009–0.012(0.011±0.004)

Ventriculus
  • L:

  • W:

  • 0.018–0.021(0.019±0.006)

  • 0.036–0.050(0.043±0.002)

  • 0.022–0.023(0.023±0.007)

  • 0.041–0.047(0.043±0.002)

Ventricular appendix
  • L:

  • W:

  • 0.10–0.12(0.11±0.007)

  • 0.036–0.054(0.045±0.001)

  • 0.135–0.151(0.15±0.02)

  • 0.051–0.066(0.058±0.007)

Distance of anus from tail tip0.033-0.039(0.034±0.004)0.039–0.041(0.040±0.01)
Mucron
  • L:

  • W:

  • 0.0032–0.0036(0.0034)

  • 0.0018–0.0028(0.0023)

  • 0.005–0.006(0.0058±0.001)

  • 0.003–0.005(0.004±0.001)

Ratio of Caeca : Ventricular Appendix1:1.921:1.84
Weight/Length ratio of ventriculus1:2.21:2.12
Length ratio of ventriculus : ceca1:0.0861:0.080
Table 2.

Comparative chart of measurements of Anisakis 3rd stage larvae infesting different hosts, inclusive of those given in earlier reports.

AuthorsAnisakis spp.HostBodyNo. of Examined HostsOesophagus LengthVentriculus LengthMucron Length
LengthWidth
Hurst (1984)Anisakis simplex 3rd stage larvaeFish (Thyrsites atun)20.26±3.04--1.99±0.210.69±0.090.023±0.004
Larizza and Vovlas (1995)Anisakis simplexMerluccius merluccius21.60±3.470.41±0.05-2.65±0.290.70±0.080.11±0.01
Quiazon, Yoshinaga, Ogawa, and Yukami (2008)Anisakis pegreffiiDelphinus delphis11.10–26.780.38–0.60-1.04–2.110.50–0.780.02–0.03
Quiazon, Yoshinaga, Ogawa, and Yukami (2008)Anisakis simplexDelphinus delphis12.75–29.940.45–0.75-1.18–2.580.90–1.500.02–0.03
Setyobudi, Jeon, Lee, Seong, and Kim (2011)Anisakis simplexOncorhynchus keta23.62±1.870.56±0.04-2.06±0.251.14±0.130.021±0.004
Pardo-Gandarillas, Lohrmann, Valdivia and Ibáñez (2009)Anisakis physeterisEtmopterus spinax27–330.63–0.74-1.82–2.890.53–0.650.17–0.32
Murata, Suzuki, Sadamasu and Kai (2011)Anisakis paggiaeBeryx splendens18.22±2.280.54±0.07-1.59±0.19--
Setyobudi, Jeon, Lee, Seong, and Kim (2011)Anisakis simplexM. merluccius lessepsianus20.4±1.20.55±0.02-2.12±0.200.82±0.10.025±0.02
Abou-Rahma et al. (2016)Anisakis simplexMerluccius merluccius lessepsianus14.1–25.60.48–(20.4±1.2)
0.62 (0.55±0.02
601.18–2.68 (2.12±0.2)0.71–0.92 (0.82±0.1)0.019–0.032 (0.025 ± 0.02)
Roca-Geronesa, Segoviab, Godinez-Gonzaleza, Fisaa and Montoliua (2020)Anisakis pegreffiiTrachurus trachurus (Horse mackerrel)16.9±0.520.45±0.06-1.70–1.860.19–0.310.05–0.12
Roca-Geronesa, Segoviab, Godinez-Gonzaleza, Fisaa and Montoliua (2020)Anisakis simplexTrachurus trachurus (Horse mackerrel)17.7±0.210.45±0.001-1.39–2.450.71–1.150.05–0.13
Hien, HV, Dung, BT, Ngo, HD & Doanh, PN (2021)Anisakis simplexMerluccius merluccius18.60±1.30.29±0.00-18.60+1.1x
0.64±0.04
1.54±0.03x
0.64±0.04
0.025±0.005
Mostafa (2023)Anisakis simplexDelphinus delphis18.0±2.10.45±0.02-1.35±0.021.35±0.020.018±0.002
Author's study (2024)Anisakis typica 3rd stage LarvaeSillago sihama7.57±1.790.25±0.06490.44±0.050.018–0.023 (0.023±0.007)0.033–0.041 (0.040±0.01)

In Asian context, Chaiphongpachara et al. (2022) recorded outbreak of A. typica from the Gulf of Thailand; Suryani et al. (2021); and Palm et al. (2008) too recorded its outbreak from an Indian Mackerel, i.e., R. kanagurta from Indonesia, in Asian sub-continent. Summarily, a total of 9 species of Anisakis are known to have existed world-over: A. simplex s.s., A. pegreffii, A. simplex C., A. typica, A. ziphidarum, A. nascettii, A. brevispiculata, A. paggiae and A. physeteris (Jeon and Kim, 2015; Setyobudi et al., 2011; Mattiucci et al., 2008) in oceans around India.

The report of Suzuki et al. (2021) concluded that though several cases of human anisakiasis are being recorded in Japan each year, their probable association with two commonly occurring species of Anisakis viz., A. pegreffii and A. simplex (s.s.) were apparent. However, no genetic confirmation of occurrence of A. typica has been available.

None of the fish in India has been reported harbouring A. typica, to date, which has immense zoonotic significance attached to its prevalence world over (Koie et al., 1995; Matos et al., 2001; Mello et al., 2011; Reis et al., 2003; Arizono et al., 2012; Mattiucci et al., 2013; Suzuki et al., 2021). Although the surveys continued in Arabian Sea by the authors and co-workers for long, and members of Anisakidae that have the potential of transformation along evolutionary lines were recently discovered with essential constituents of ventriculus, excretory pore, genital pore along with oral aperture being atop cephalic complex in Rotundocollarette capoori (Yadav et al., 2022), in addition to buccal tooth, and the raphidascaridoid worms, Rostellascaris spinicaudatum in marine fish as well as in another fish (Jaiswal et al., 2024) along Central west coast of India. The Indian sand whiting, Sillago sihama (Family: Percomorphoidea) is a significant component of coastal and estuarine fisheries of India. Parasitic fauna of this fish in Indian Ocean has been scarcely studied (Malhotra et al., 2012), while fish are the known target of commercialization of fresh, frozen, canned, smoked, salted or dried (Reddy, 1991; Vishal, 2024). The mainstays of the Japanese Sushi shop and eating at cheap Kaitenzushi (Conveyor belt sushi restaurants) have ensured effective encroachment into Indian feedings habits. This certainly could extend as risk to human consumption in India. Indian cuisine similar to Japanese cuisine ‘Sushi’, is traditionally altered for preparation with seafood (Reddy, 1991; Padiyar et al., 2024; Vishal, 2024), particularly Indian sand whiting or other fish or crab meat. It became dry, if overcooked, and is preferred as a substitute of pork, as explained by Wakeelah (Reddy, 1991). The dietary shift in Indian sand whiting was recorded by Reddy (1991). The fishmeal production becomes a mechanism for transmission of larval and developmental stages of nematodes to fish. Indian mackerel (Rastrelliger spp.) from the waters around coastal areas of other countries in Bay of Bengal, like Bangladesh, have been the common subjects of study to investigate the infesting ascaridoid worms of genus Anisakis (Nematoda: Anisakidae), but the Indian coastal waters were not surveyed. Instead, the reports on worms of Anisakidae infesting Indian Mackerel appeared from Indian Ocean, Southern coast of East Java and Bangladesh (Bao et al., 2022; Suryani et al., 2021). Being a coastal state and leading fish producer of the country, both fresh and dried fish are important items of Kerala diet (Tables 3, 4, 5)(Sajeev et al., 2021). Fish consumption per capita of 2.26Kg in rural and 2.21Kg in urban areas has been concluded in Kerala State (NSSO, 2012).

Table 3.

Frequency of consumption of various non-vegetarian food items reported by households in Kerala.

AttributesPercentageFresh PrawnDried FishDried prawn
Never100%-
Others90–100%62182196
On special occasions30–80%20910477
More than once a week10–30%91121141
Almost Everyday0–10%49--
Table 4.

Per capita monthly consumption of fish v/s other meat in Malappuram, Kerala.

S. No.Items consumedPer capita consumption (kg/month)
1.Fish2.6
2.Chicken0.8
3.Beef0.6
4.Mutton0.4
5.Pork0.0
Table 5.

Most purchased fish species in Malappuram, Kerala.

S. No.Fish SpeciesPurchased by (%)
1.Sardine91
2.Mackerel60
3.Sole fish20
4.Cod fish14
5.Squid8.5
6.Prawns8
7.Tuna6.5
8.Pomfret5.5
9.Tilapia4.5
10.Seer fish4
11.Shark3.5
12.Malabar trevally3
13.Threadfin bream2.5
14.Clams1.5
15.Pearl spot1
16.Ribbon fish1

Molecular characterization

The read length of all 18S sequences was 972 bp, of all ITS1 sequences was 380 bp, and of all ITS2 sequences was 456 bp.

The larger clade of A. typica incorporating specimen under current investigation (KF633462) was entirely segregated in the tree based on ITS2 sequences (Table 6). The monophyletic association with the 100 % support of Boot strap value comprised KF633462, KY524217 (p distance, 0.00), LN651099 (p distance, 0.00), ON065560 (p distance, 0.00), JQ798962 (p distance, 0.00), and MT635343 (p distance, 0.00)(Fig. 2).

Table 6.

Representative groups of ITS2 gene sequences selected for the study.

GenBank Accession No.GeneTaxonReference
JQ798962ITS2Anisakis typicaBorges et al. (2012)
MT635343ITS2Anisakis typicaBorges et al. (2021)
ON065560ITS2Anisakis typicaBao et al. (2022)
LN651099ITS2Anisakis typicaShamsi et al. (2015)
KF633462*ITS2Anisakis typicaPresent study
KY524217ITS2Anisakis typicaPalm et al. (2017)
JQ912692ITS2Anisakis nascettiiMattiucci et al. (2014)
FN556997ITS2Anisakis sp.Shamsi et al. (2012)
FR716448ITS2Anisakis pegreffiiShamsi (Unpublished)
LC745135ITS2Anisakis simplexIkebuchi (Unpublished)
LC666445ITS2Anisakis sp.Hirata et al. (Unpublished)
MK325217ITS2Anisakis sp.Shamsi et al. (2019)
MF768443ITS2Anisakis sp.Quiazon et al. (Unpublished)
MF358544ITS2Anisakis simplexCipriani et al. (2017)
HQ616674ITS2Anisakis simplexMeloni et al. (2011)
JF424598ITS2Contracaecum bioccaiD'Amelio et al. (Unpublished)
KY018601ITS2Hysterothylacium aduncumPawlak et al. (2018)
KY524217ITS2Anisakis typicaPalm et al. (2017)

* Current investigation

Fig. 2.

Neighbour-joining tree based on nucleotide ITS2 sequences and reference species. Nucleotide ITS2 sequence data are as described in the text with GenBank accession numbers. Bootstrap values based on 1000 replicates were used. Scale bar represents an interval of the Kimura two-parameter (K2P) model.

*Current investigation

Neighbour joining tree distinctly delineated the larger clade that comprised as many as six specimens of A. typica, though the second clade contained 3 sub-clades, the first one comprising twin A. nascettii (JQ912692 and JX486104); with twin Anisakis spp. (MK325217 and MF768443) with bootstrap values depicting 99 % alignment, and lastly, A. pegreffii (FR716448); with LC745135 and LC666445 of A. simplex along with Anisakis sp. (FN556997) showing 100 % bootstrap value clustered together to form non-A. typica sub-clade. Hysterothylacium aduncum (KY018601) formed an outgroup. The monophyletic association with the 100 % support of Boot strap value comprised KF633462, KY524217 (p distance, 0.00), LN651099 (p distance, 0.00), ON065560 (p distance, 0.00), JQ798962 (p distance, 0.00), and MT635343 (p distance, 0.00) based on Internal Transcribed Spacer gene. Three smaller subclades that comprised 2, 4 and 2 specimens, respectively, confirmed divergence of nucleotides within genus Anisakis, with the genetic distance being p = 0.00 for the specimens, namely, A. nascettii (JQ912692); A. pegreffii (FR716448); A. simplex (LC745135); A. simplex (LC666445), and p distance, 0.313 (JX486104); 0.1774 (FN556997); A. simplex (MK325217), p distance, 0.4206; and (MF768443) p distance, 0.1086.

Neighbour joining tree clearly indicated two distinct clusters among specimens from different populations based on ITS1 gene (Fig. 3; Table 7). A. typica specimens from this study were grouped at the top of the clade, with the specimens from the present study (KF633459; p distance 0.00) exhibiting monophyletic association with AB432909; p distance 0.004) and MW315550; p distance 0.00). Bootstrap supports were found to be 98 % for the remaining 4 specimens (AB479120; MF642336; JX848665 (p distance 0.0001); KX098561 (p distance 0.0039)) nucleotides within the same clade. The divergence of populations of A. typica was apparent under the remaining 5 distinct clusters from Japan (LC621351; K2p distance, 0.035), Australia (FN557239, p distance, 0.008; FN557233, p distance, 0.008; FN391859, p distance 0.013) and one human being from Italy (JQ912692, p distance, 0.119), based on ITS1 gene. Hysterothylacium aduncum (KY018601) was taken as outgroup.

Fig. 3.

Neighbour-joining tree based on nucleotide ITS1 sequences and reference species. Nucleotide ITS1 sequence data are as described in the text with GenBank accession numbers. Bootstrap values based on 1000 replicates were used. Scale bar represents an interval of the Kimura two-parameter (K2P) model.

*Current investigation

Table 7.

Representative groups of ITS1 gene sequences selected for the study.

GenBank Accession No.GeneTaxonReference
KX098561ITS1Anisakis typicaAndres et al. (2016)
JX848665ITS1Anisakis typicaJabbar et al. (2017)
MF642336ITS1Anisakis typicaShamsi et al. (2017)
AB479120ITS1Anisakis typicaUmehara et al. (Unpublished)
AB432909ITS1Anisakis typicaUmehara et al. (Unpublished )
MW315550ITS1Anisakis typicaSuthar and Shamsi (2021)
KF633459ITS1Anisakis typicaPresent study*
JQ912692ITS1Anisakis nascettiiMattiucci et al. (2014)
LC621351ITS1Anisakis simplexSato et al. (Unpublished)
FN557239ITS1Anisakis sp.Shamsi (Unpublished)
FN557233ITS1Anisakis sp.Shamsi (Unpublished)
FN391859ITS1Anisakis pegreffiiShamsi et al., (2012)
MF358544ITS1Anisakis simplexCipriani et al., (2017)
JF424598ITS1Contracaecum bioccaiD'Amelio et al., (Unpublished)
HQ616674ITS1Anisakis simplexMeloni et al.,(2011)
HQ616675ITS1Anisakis simplexMeloni et al.,(2011)
KY018601ITS1Hysterothylacium aduncumPawlak et al.(2018)
KY524217ITS1Anisakis typicaPalm et al.(2017)
KY524213ITS 1Anisakis typicaPalm et al. (2017)

* Current investigation

The monophyletic association of specimens of A. typica aligned closely to form major clade, based on 18S rDNA gene comprising six specimens conspecific (p distance= 0.0-0.026) to the worms of A. typica (KF636791, p distance= 3.438) under study (Fig. 4; Table 8). As many as six A. typica specimens were part of the larger clade that comprised total nine conspecific (p distance=0.001–0.006) along with three other specimens (A. simplex; A. pegreffii and A. physeteris) based on 18S rDNA gene. The twin A. pegreffii (HE997162) and A. typica (KF636791) conformed to the outgroup (p Distance=2.09).

Fig. 4.

Neighbour-joining tree based on nucleotide 18S rDNA sequences and reference species. Nucleotide 18S rDNA sequence data are as described in the text with GenBank accession numbers. Bootstrap values based on 1000 replicates were used. Scale two-parameter (K2P) model.

*Current investigation

Table 8.

Representative groups of 18S rDNA gene sequences selected for the study.

GenBank Accession No.GeneTaxonReference
JF41202818S rDNAAnisakis simplexLalle et al.(Unpublished)
AY82173918S rDNAAnisakis simplexNadler et al., (2004)
AB27782118S rDNAAnisakis physeterisUmehara et al.,(2008)
EU62434318S rDNAAnisakis pegreffiiQuiazon et al.,(2008)
EU62434218S rDNAAnisakis simplexQuiazon et al., (2008)
AY82672418S rDNAAnisakis typicaD'Amelio et al.,(Unpublished)
AB43290818S rDNAAnisakis typicaUmehara et al., (2008)
AB47912018S rDNAAnisakis typicaUmehara et al., (2010)
JX52371518S rDNAAnisakis typicaZhang et al.,(2013)
KC92826218S rDNAAnisakis typicaAnshary et al., (2014)
KF636791*18S rDNAAnisakis typicaJaiswal et al., (2013)
EF18008218S rDNAAnisakis pegreffiiNadler et al., (2007)
JQ79896218S rDNAAnisakis typicaBorges et al., (2012)
HE99716218S rDNAAnisakis pegreffiiDe Luca et al., (Unpublished)

* Current investigation

Conclusions

The maiden investigation has been presented herein to record Anisakis typica 3rd stage larvae within the maritime zones of Indian sub-continent. Although A. typica was reportedly widely distributed in warmer temperate and tropical seas under influence of diverse migratory habits of their definitive fish hosts, yet these were not recorded in Indian seas earlier. The requirements of food safety would warrant strict monitoring so that the best practices could be galvanized to generate an effective safety environment in public health. The coral reef-linked associations of the marine fish coral trout Paracamallanus areolatus inhabiting Red Sea in Egypt highlighting these flourishing associations in foreign seas with A. typica brought to knowledge the coral reef-associated promotion of A. typica and cohabitant populations of agents of anisakiasis in Indian subcontinent in the present study. Thus the significance of intense activity of the etiological agent of the gastrointestinal zoonotic disease, anisakiasis (viz, A. typica and R. capoori) in the reef-associated Goan coastal areas, were noticeable. No other infections co-occurred in these reef-associated coastal fish fauna.

Notes

[4] Contributed by Author Contributions

Conceptualization, S.K.M., Collection & Investigation, N.J. & A.Y., Writing—Original Draft Preparation, S.K.M.; Writing—Review & Editing, N.J. & A.Y.; Visualization, A.Y. All authors read and approved the final version of the manuscript.

[5] Funding

This research is a part of independent research, and the findings of research investigations presented here were not part of any funded research project, nor any funding was received to conduct this research.

[6] Conflicts of interest Conflict of Interest

Authors have no potential conflict of interest pertaining to this submission to Helminthologia whether financial or non-financial, professional, or Proceedings from a Conference.

DOI: https://doi.org/10.2478/helm-2024-0027 | Journal eISSN: 1336-9083 | Journal ISSN: 0440-6605
Language: English
Page range: 232 - 243
Submitted on: Feb 7, 2024
Accepted on: Sep 10, 2024
Published on: Dec 12, 2024
Published by: Slovak Academy of Sciences, Institute of Parasitology
In partnership with: Paradigm Publishing Services
Publication frequency: Volume open

© 2024 A. Yadav, N. Jaiswal, S. K. Malhotra, published by Slovak Academy of Sciences, Institute of Parasitology
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.