Discovery of a new genus and species of Allocreadiidae (Trematoda) in Mexico: Mesoamericatrema magnisacculus n. gen. n. sp

As a part of the study of helminth parasites of fishes in the Lacantún River from the Biosphere Reserve of Montes Azules, Chiapas, Mexico, 53 individuals of Atherinella alvarezi were caught using by electrofishing and cast nets in some tributaries and the main channel of the Lacantún River, next to the Chajul Station (16°06’38.4’’ N, 90°56’23.6’’ W) during January 2018. The fish were transported alive to a temporary field necropsy station, where they were necropsied for metazoan parasites by dissecting them and checking all the organs. Particularly, the gastrointestinal tract of each fish was placed in Petri dishes with some 6.5 % saline solution for examination under a stereomicroscope.

The trematodes of the same morphotype were separated into two groups: some were killed and fixed with 4 % hot (nearly boiling) formaldehyde and

stored in vials for morphological study; others were placed directly into vials with absolute ethanol while still alive for DNA extraction and molecular studies.

Of the specimens fixed in 4 % formaldehyde for morphology, 28 were stained with Gomori´s trichrome and Mayer’s paracarmine, cleared in methyl salicylate, and mounted in Canada balsam. These specimens were observed, measured, and drawn using an Olympus DIC Nomarski-BX50 microscope (Olympus Corporation, Tokyo, Japan) equipped with a drawing tube; measurements are presented in micrometers (μm) with the range followed by the mean in parentheses. Two other specimens were processed for scanning electron microscopy (SEM) as follows: specimens were dehydrated in a graded ethanol series (30 %, 50 %, 70 %, 96 % and 100 %), dried at the critical point with carbon dioxide; these specimens were mounted on a metal stub with carbon adhesive tabs, then gold coated, and examined at 10 kV with a Hitachi Stereoscan SU1510 SEM (Hitachi Ltd., Chiyoda, Tokyo, Japan). Specimens were deposited in the Colección Nacional de Helmintos UNAM (CNHE), in the Colección Helmintológica from CINVESTAV Mérida (CHCM), in Natural History Museum of Geneva (MHNG).

To extract genomic DNA, five specimens were digested separately, using the REDExtract-N-Amp Tissue PCR kit (Sigma, St. Louis, Missouri, USA) following the manufacturer’s instructions. Proteinase was denatured at 95º C for 3 min. The ITS (ITS1+5.8S+ITS2) region and 28S rRNA gene (Domains D1+D2+D3) were amplified using polymerase chain reaction (PCR). For ITS, the primers BD1 5′–GTCGTAACAAGGTTTCCGTA–3′, and BD2 5′–TATGCTTAAATTCAGCGGGT–3′ (Luton et al., 1992) were used; for the 28S, the primers 391 5′-AGCGGAGGAAAAGAAACTAA-3′ (Nadler & Hudspeth, 1998) and 536 5’-CAGCTATCCTGAGGGAAAC-3’ (Stock et al., 2001) were used. The PCR was performed in a final volume of 25μl containing 2 μl of genomic DNA, 14.25 μl of ultrapure water, 1 μl of each primer, 2.5 μl of 10x buffer A, 1.5 μl of MgCl₂ at 25 mM, 2.5 μl of dNTPs at 2 mM, and 0.25 μl (1 U) of Taq DNA polymerase (Vivantis, Shah Alam, Selangor Darul Ehsan, Malaysia). All PCR reactions were run in an Axygen® MaxyGene™ II thermocycler. Thermal cycling conditions for both ITS and 28S consisted of 95°C for 5 min followed by 35 cycles of 94°C for 1 min, 50 °C for 1 min and 72°C for 1 min, with a final extension at 72 °C for 10 min. Sequencing was performed using the amplification primers plus the internal primers: 503 5’-CCTTGGTCCGTGTTTCAAGACG-3’ (Stock et al., 2001) and 504 5’-CGTCTTGAAACACGGACTAAGG-3’ (García-Varela & Nadler, 2005) for 28S; BD3 5′-GAACATCGACATCTTGAACG-3′ and BD4 5′-ATAAGCCGACCCTCGGC-3′ (Hernández-Mena et al., 2014) for ITS. PCR products were sequenced using an ABI 3500xL Genetic Analyser (Applied Biosystems, Waltham, Massachusetts, USA) in the Laboratorio de Secuenciación Genómica de la Biodiversidad y de la Salud, Instituto de Biología, Universidad Nacional Autónoma de México. Finally, from the resulting sequences, a consensus sequence was obtained for each gene of each extracted specimen using the Geneious Pro 4.8.4 software (Biomatters Ltd., Auckland, New Zealand). Sequences were submitted to GenBank.

Phylogenetic analyzes were performed for the 28S gene, because it is the gene with most sequences for species of Allocreadidae. To build this dataset, most of the sequenced species available in Genbank were added (see Table 1) using the Mesquite 3.62 software (https://www.mesquiteproject.org/). Callodistomidae species were used as outgroup for rooting the trees. The alignment of the sequences was performed with the SATé software, using the following configuration: Aligner = MAFT, Merger = MUSCLE, Tree Estimator = RAXML, Model = GTRCAT, Iteration limit= 200, Tree Return= Best (Liu et al., 2009, 2012). The best alignment was selected for phylogenetic analyses. Nucleotide substitution was estimated with jModelTest v2 (Darriba et al., 2012). Phylogenetic trees were generated with maximum likelihood (ML) and Bayesian inference (BI). For ML analysis, RaxmlGUI v. 1.3 software (Silvestro & Michalak, 2012) was employed to estimate the best tree under the GTR+I+G model and where 1,000 bootstrap repetitions (Bt) were run to estimate the support of the nodes. For the BI analysis we used MrBayes v. 3.2.1 (Ronquist et al., 2012), in which four independent MCMC runs of 20 million generations each were performed. For each run, four chains with a heating parameter value of 0.9 were employed, and the tree topologies were sampled every 1000 generations (printfreq = 1000 sample-freq = 1000 diagnfreq=10,000). Burn-in periods were set to the first 1500 generations. Nodal support was estimated as posterior probability values (PP) and a 50 % majority-rule consensus tree was obtained. The phylogenetic trees obtained were visualized in FigTree v. 1.4.2. Finally, genetic distances were calculated as uncorrected p-distance in MEGA v6 Software (Tamura et al., 2013).

Family: Allocreadiidae Looss, 1902

Genus: Mesoamericatrema Hernández-Mena, Mendoza-Garfias and Vidal-Martínez

Diagnosis. Body oval, widest at the level of ventral sucker. Tegument smooth, aspinose. Eyespot pigment present and scattered in forebody. Forebody with tegumental papillae on lateral sides.

Oral sucker spherical, subterminal, with oral papillae, 6 or more anterior external, 4 on inner surface (2 near mouth) and 5 posterior external. Oral lappets or lobes lacking. Ventral sucker spherical, muscular, slightly larger than oral sucker. Mouth subterminal. Prepharynx absent. Pharynx rounded, muscular. Esophagus short. Intestinal bifurcation in mid-forebody; caeca terminating at level of posterior testis. Testes two, rounded, entire, tandem, overlapping or slightly separate, in posterior half of hindbody. Cirrus sac very large in proportion to body length, elongate, median, claviform, extending to ovary. Seminal vesicle unipartite, continuous. Pars prostatica ovoid. Ejaculatory duct longer than pars prostatica. Cirrus not observed. Genital atrium indistinct. Genital pore median, between intestinal bifurcation and ventral sucker. Ovary globular, smooth, sinistral, post-equatorial, pre-testicular, posterior to ventral sucker. Seminal receptacle flask-shaped. Mehlis’ gland between ovary and anterior testis. Laurer’s canal opening on dorsal surface of body. Vitelline follicles large, in two ventro-lateral fields not confluent, from intestinal bifurcation to posterior end of body. Uterus not extending posteriorly beyond anterior margin of anterior testis, with few eggs (from 2 to 5). Metraterm similar in length to cirrus sac. Eggs oval and operculate. Excretory vesicle I-shaped, extending to anterior testis. Excretory pore terminal. Parasites in the intestine of atherinopsids (Atheriniformes: Atherinopsidae), in Middle America.

Type species: Mesoamericatrema magnisacculus Hernández-Mena, García-Teh and Caspeta-Mandujano n. sp.

Type host: Atherinella alvarezi (Díaz-Pardo, 1972), Gulf silverside (= Plateadito de Tacotalpa in spanish) (Atheriniformes: Atherinopsidae).

Infection site: Intestine.

Type locality: Arroyo San José, Chiapas, Mexico (16°06’50.0” N, 90°56’03.3” W).

Other localities: Arroyo San Pablo, Chiapas, Mexico (16°06’10.0” N, 91°00’52.2” W).

Etymology: The name of the genus reflects the fact that the type species is distributed in Mexico, in a portion of the cultural region known as “Mesoamerica” that includes from the southern half of Mexico to Nicaragua.

Zoobank Life Science Identifier: urn:lsid:zoobank. org:act:733A83FD-3C04-4304-A1D4-507F2CD12090

Description (Based on 19 adult specimens from Arroyo San José, and 9 adult specimens from Arroyo San Pablo, Chiapas, Mexico; Figs 1, 2 and 3). Body aspinose, oval, small, 465–710 (574) long, maximum width 155–230 (201) at posterior region of ventral sucker; anterior end rounded. Tegument smooth. Eyespot pigment scattered in forebody at level of pharynx. Forebody, 140–200 (162) long; forebody length to total body length ratio 1: 3.3–3.6 (3.5). Hindbody with ventro-lateral tegumental papillae in the first half of the segment, 232–400 (314) long; forebody length to hindbody length ratio 1:1.6–2.3 (1.9), first half of hindbody with ventro-lateral tegumental papillae. Oral sucker spherical, subterminal, 62–85 (69) long, 67–75 (70) wide, with oral papillae: 6 or more anterior external, 4 on inner surface (2 near mouth) and 5 posterior external (Fig. 2). Oral lappets or lobes lacking (Fig. 2). Mouth subterminal. Ventral sucker spherical with circular opening, larger than oral sucker, muscular, 88–110 (97) long by 85–102 (96) wide. Oral sucker length to ventral sucker length ratio 1: 1.3–1.6 (1.4); Oral sucker width to ventral sucker width radio 1:1.3–1.5 (1.4Prepharynx absent. Pharynx rounded, muscular 30–45 (36) long by 33–40 (36) wide. Esophagus very short, almost imperceptible and narrow. Intestinal bifurcation in mid-forebody, 95–120 (103) from anterior end of body; caeca long, narrow, terminating at level of the posterior testis, 332–462 (380) long, 15–25 (19) wide. Testes two, symmetrical, rounded, smooth, entire, medial, tandem, overlapping or slightly separate, located in posterior half of hindbody. Anterior testis 50–55 (52) long by 45–57 (52) wide. Posterior testis 49–62 (54) long by 49–60 (54) wide, to 65–125 (84) from posterior end of body. Cirrus sac elongate, median, dorsal, claviform, narrower anteriorly and much broader posteriorly, extending from genital pore to anterior half of ovary, 176–332 (224) long, 83–112 (100) wide; cirrus sac length to body length ratio 1: 2.1–2.9 (2.6). Seminal vesicle unipartite, folded, continuous, in posterior part of cirrus-sac, 50–100 (62) long, 50–80 (61) wide. Pars prostatica ovoid 45–62 (52) long by 12–30 (24) wide, surrounded by prostatic cells. Ejaculatory duct longer than pars prostatica, 67–117 (91) long by 10–20 (13) wide. Cirrus not observed. Genital atrium indistinct. Genital pore slit-like, median, between the intestinal bifurcation and the ventral sucker. Ovary globular, unlobed, margin smooth, 52–75 (64) long, 50–75 (61) wide, sinistral, post-equatorial, pre-testicular, between ventral sucker and anterior testis, at 37–78 (56) from posterior margin of ventral sucker. Seminal receptacle flask-shaped, 35–46 (39) long, 55–75 (62) wide, between ovary and anterior testis. Mehlis’ gland composed of scattered gland cells, between ovary and anterior testis. Laurer’s canal indistinct in most specimens, in one specimen opening on dorsal surface of body lateral to the outer border of caecum, at level of ovary. Ootype not observed. Vitellarium formed by large follicles, distributed in two ventro-lateral fields not confluent, extending from intestinal bifurcation level to near posterior extremity of body; follicles overlapping caeca ventrally; vitelline ducts uniting near seminal receptacle to form vitelline reservoir. Uterus intercaecal, forming loops between anterior testis and cirrus sac. Metraterm thick-walled, similar in length to cirrus sac. Eggs oval, operculate, few (2–5), 37–52 (47) long, 32–42 wide (38). Excretory vesicle I-shaped, 140–238 (177) long, 10–18 (14) wide, extending anteriorly to middle of anterior testis. Excretory pore terminal.

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Type host: Atherinella alvarezi (Díaz-Pardo, 1972), Gulf silverside (= Plateadito de Tacotalpa in spanish) (Atheriniformes: Atherinopsidae).

Type locality: Arroyo San José, Chiapas, México (16°06’50.0” N, 90°56’03.3” W).

Other localities: Arroyo San Pablo, Chiapas, Mexico (16°06’10.0” N, 91°00’52.2” W).

Type material: Holotype CNHE 11671; Paratypes CNHE 11672 (n=5) and CNHE 11663 (n=5); Paratypes CHCM 670 (n=4) and CHCM 671 (n=3); Paratypes MHNG PLAT-0144002 (n=4).

Representative DNA sequences: 28S rRNA (OP279638 – OP279642); ITS rRNA (OP279696 – OP279697).

Etymology: The specific name reflects the fact that this species has a cirrus sac that is huge in proportion to its body length.

Zoobank Life Science Identifier: urn:lsid:zoobank.org:act:0520E4B6-B22F-433E-AF28-C6E32A4D84A9

Phylogenetically, the new species is related to species of genera that are distributed in the Neotropical region: Creptotrema, Creptotrematina, Paracreptotrema, Paracreptotrematoides, Pseudoparacreptotrema, and Wallinia (see below for results of the phylogenetic analyses). Mesoamericatrema magnisacculus n. sp. is easily distinguishable from all species of Creptotrema and Creptotrematina, and from some species of Pseudoparacreptotrema (i. e. P. falciformis Hernández-Mena & Pinacho-Pinacho, 2020 and P. axtlaensis Mendoza-Garfias & Choudhury, 2020) because the new species lacks lappets or lobes protruding from the oral sucker.

The new species is distinguished from all species of Wallinia, Paracreptotrema, Paracreptotrematoides, and from the remaining species of Pseudoparacreptotrema, because M. magnisacculus n. sp. has a very large cirrus sac (1: 2.1–2.9) that posteriorly surpasses the ventral sucker and extends to the ovary, whereas in Wallinia species it is

is moderately elongated and only slightly extends past the ventral sucker, and in the species of Paracreptotrema, Paracreptotrematoides and Pseudoparacreptotrema is short and never extends beyond the posterior level of the ventral sucker. Additionally, the new species has testes in tandem and a pre-testicular uterus with very few eggs; Wallinia species have oblique testes and a post-testicular uterus with numerous eggs; Paracreptotrema and Paracreptotrematoides species have symmetrical testes and a uterus that contains relatively few eggs and extends into the testicular space; and Pseudoparacreptotrema species have symmetrical or oblique testes and uterus that also contains relatively few eggs and extends into the testicular space. Furthermore, M. magnisacculus n. sp. possesses non-confluent vitelline follicles while Pseudoparacreptotrema species possess confluent vitelline follicles in the post- testicular and testicular regions.

The 28S data set was formed of a matrix of 51 species in 13 genera of Allocreadiidae (see Table 1). The length of the sequences in the aligned matrix was 1500 bp. The substitution model was GTR+G+I and the nucleotide frequencies were: A= 0.212, C= 0.214, G=0.318, T=0.256. The ML tree value was –ln= 9888.861897. Both the ML tree and the BI consensus tree presented practically the same topology. Regarding the phylogenetic relationships, all genera, except for Crepidostomum and Creptotrema, were monophyletic. In the case of Creptotrema, previous studies have already suggested that C. funduli, due to its phylogenetic position and geographical distribution, is a different genus and that this species needs a new morphological and taxonomic review (Pérez-Ponce de Léon et al. 2020); therefore, Creptotema sensu stricto included the rest of the species that formed a monophyletic group. In the tree, it was observed that the phylogenetic relationships of the species were consistent with the regions where they are distributed, i.e. the Holarctic and Neotropical regions. The species of the Neotropical region formed a monophyletic clade that was made up of seven genera with high support values (Bt=88; PP=0.99), where the new genus also nested: Creptotrema, Creptotrematina, Mesoamericatrema n. gen., Paracreptotrema, Paracreptotrematoides, Pseudoparacreptotrema and Wallinia. Mesoamericatrema, was placed as the sister group of the subclade (Creptotrematina + (Wallinia + Creptotrema)) (Bt=53; PP=0.98). The genetic distances in the 28S rDNA between Mesoamericatrema magnisacculus n. sp. and the species of the genera of the sister subclade were variable: from 4.59 to 5.46 % with Creptotrematina species, from 3.94 to 6.24 % with Wallinia species and from 3.75 to 6.42 % with Creptotrema species (Table 2). On the other hand, the genetic distances in the ITS gene between Mesoamericatrema magnisacculus n. sp. and species of the genera of the sister subclade were also variable, varying from 4.81 to 5.65 % with Creptotrematina species, 5.12 % with Wallinia chavarriae and from 4.40 to 4.94 % with Creptotrema species (Table 2).