Occurrence and seasonal changes in the population of root-knot nematodes on honeybush (Cyclopia sp.)

F. Y. Daramola; R. Malgas; A. P. Malan

doi:10.2478/helm-2021-0018

.blurhash-client-img { display: none !important; }

Occurrence and seasonal changes in the population of root-knot nematodes on honeybush (Cyclopia sp.)

Helminthologia

Volume 58 (2021): Issue 2 (June 2021)

By: F. Y. Daramola, R. Malgas and A. P. Malan

Open Access

|Jun 2021

Figures & Tables

Google Earth image showing the location of the sampling sites in the Western Cape province of South Africa.

Mean population density of root-knot nematode (RKN) and other plant-parasitic nematode (PPN) associated with honeybush cultivation on six sites at Genadendal, Western Cape province of South Africa (2016-2017). Error bars represent standard errors (±SE).

Mean population density of root-knot nematode (RKN) associated with honeybush cultivation at six sampling sites in Genadendal, Western Cape province of South Africa (2016-2017). Error bars represent standard errors (±SE).

Seasonal fluctuation and changes in the nematode population during the sampling period of 2016-2017 at the six experimental sites in Genadendal, Western Cape province of South Africa.

Symptoms of RKN damage on honeybush roots.

A-B: Healthy flowering honeybush plants. C-D: Nematode damage on honeybush field, showing loss of plant.

Gel pictures obtained from the amplification of DNA products of single J2s of RKN from honeybush plots. a. Meloidogyne javanica (amplified with FJav/Rjav primers) and b. M. hapla (with JMV1/JMV2 & JMV primers).

Temperature and rainfall distribution around Genadendal, Western Cape province (2016 – 2017)_

	2016			2017
Month	Temperature °C (max)	Temperature °C (min)	Rainfall (mm)	Temperature °C (max)	Temperature ⁰C (min)	Rainfall (mm)
January	32.37	19.34	0.26	29.89	16.29	1.4
February	30.59	16.82	0.34	30.73	17.48	0.14
March	26.95	16.06	1.11	30.09	15.07	0.09
April	26.08	13.63	0.89	28.79	14.34	0.92
May	24.31	11.22	0.34	25.11	11.79	0.33
June	20.03	8.48	2.05	20.44	7.51	0.82
July	18.68	8.2	2.72	18.96	7.09	0.4
August	21.55	8.83	1.47	17.28	7.55	1.65
September	21.06	9.34	0.77	20.56	8.66	0.58
October	25.74	11.23	0.25	22.1	9.37	0.79
November	28.04	13.99	0.18	24.27	12.5	1.27
December	31.05	16.07	0.19	26.92	14.98	0.27

Primer codes used for identification of Meloidogyne species, sequences and sources_

Species	Primer	Sequence 5'-3'	Source
M. arenaria	Far	TCGGCGATAGAGGTAAATGAC	M. arenaria-specific SCAR
	Rar	TCGGCGATAGACACTACAAACT	Zijlstra et al. (2000)
M. javanica	Fjav	GGTGCGCGATTGAACTGAGC	M. javanica-specific SCAR
	Rjav	CAGGCCCTTCAGTGGAACTATAC	Zijlstra et al. (2000)
M. incognita	MI-F	GTGAGGATTCAGCTCCCCAG	M. incognita-specific SCAR
	MI-R	ACGAGGAACATACTTCTCCGTCC	Meng et al. (2004)
M. hapla	JMV1	GGATGGCGTGCTTTCAAC	M. hapla-, M. chitwoodi-and
	JMV2	TTTCCCCTTATGATGTTTACCC	M. fallax-specific IGS-SCAR
	JMVhapla	AAAAATCCCCTCGAAAAATCCACC	Wishart et al. (2002)

References

Authors

Metrics

Articles in this issue

DOI: https://doi.org/10.2478/helm-2021-0018 | Journal eISSN: 1336-9083 | Journal ISSN: 0440-6605

Journal RSS Feed

Language: English

Page range: 202 - 212

Submitted on: Jul 7, 2020

Accepted on: Feb 24, 2021

Published on: Jun 8, 2021

Published by: Slovak Academy of Sciences, Institute of Parasitology

In partnership with: Paradigm Publishing Services

Publication frequency: Volume open

Keywords:

Meloidogyne hapla,

Meloidogyne javanica,

Related subjects:

Zoology,

Ecology,

Life sciences, other,

Medicine,

Clinical medicine,

Microbiology, virology and infection epidemiology

© 2021 F. Y. Daramola, R. Malgas, A. P. Malan, published by Slovak Academy of Sciences, Institute of Parasitology
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Volume 58 (2021): Issue 2 (June 2021)

Occurrence and seasonal changes in the population of root-knot nematodes on honeybush (Cyclopia sp.)

Figures & Tables

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Fig. 6

Fig. 7

Temperature and rainfall distribution around Genadendal, Western Cape province (2016 – 2017)_

Primer codes used for identification of Meloidogyne species, sequences and sources_

Paradigm

My account