Figure 1.
Figure 2.
Figure 3.
Figure S1.
Figure S2.
Figure S3.
Figure S4.
Figure S5.
Figure S6.
Figure S7.
Figure S8.
Figure S9.
Assay qPCR reagents and volumes per sample tube_
| Reagent | Volume | Notes |
|---|---|---|
| 2X qPCR Master Mix | 15 μl | |
| Primers (fluoPCR test primer F and fluoPCR test primer R) | 7.5 μl | F: 5′CTGAAGTCTTACGAGGAAGAGTTGG3′ |
| R: 5′TCAGGAGAGCGTTCACCGACAAAC3′ | ||
| DNA volume | 7.5 μl | DNA replaced by water in the negative control |
| Total Volume | 30 μl |
Parameters for PCR amplification of the target sequences_
| Step | Time (s) | Temperature (°C) |
|---|---|---|
| 1. Initial Denaturation | 60 | 94 |
| 2. Denaturation | 8 | 94 |
| 3. Annealing | 8 | 55 |
| 4. Extension | 8 | 72 |
| 5. Transfer to GIS Viewer and Image Capture | ||
| Every two PCR cycles (starting at cycle 2 for the 100- and 400-bp targets and cycle 18 for the 1600-bp target) | ||
| 6. Reinsert in miniPCR and repeat steps 2-5 | 36 cycles | |
| 7. Final Extension | 300 | 72 |
Comparison of standard deviation between duplicates from the 100- and 400-bp samples from the fluoPCR and qPCR runs_ Standard deviations were calculated with √[ Σ(xi − x̄)2 / (n−1) ] for each set of conditions_
| Standard deviation of spaceflight fluoPCR samples between duplicates | ||
| amol | Std dev for 100-bp | |
| 25 | 0.00 | 0.00 |
| 1.56 | 1.41 | 0.00 |
| 0.0975 | 0.00 | 0.00 |
| Standard deviation of ground fluoPCR samples between duplicates | ||
| amol | Std dev for 100-bp | |
| 25 | 0.00 | 1.41 |
| 1.56 | 0.00 | 0.00 |
| 0.0975 | 0.00 | 1.41 |
| Standard deviation of ground qPCR samples between duplicates | ||
| amol | Std dev for 100-bp | |
| 25 | 0.00 | 0.00 |
| 1.56 | 0.71 | 0.71 |
| 0.0975 | 0.00 | 0.71 |