Figure 1

Figure 2

Figure 3A

Figure 3B

Figure 4

Overall transcription levels for 70% ethanol and RNAlater®-fixed roots and shoots of two-day-old Brassica rapa seedlings_ The values represent the average fold-ratio of examined genes (ACT7, SUS, UBQ1, COX1, Hsp70, and Hsp90) between columns (stress/slow fixation) and rows (immediate, complete submersion in the respective fixative)_
| EtOH | Slow fixation | ||
|---|---|---|---|
| Root | Shoot | ||
| Fast fixation | Root | 1.0 | |
| Shoot | 1.6 | ||
| RNAlater® | |||
| Root | 5.0 | ||
| Shoot | 2.5 | ||
Absorbance ratios for RNA extractions of samples extracted by Qiagen RNeasy Plant Mini Kit_ The 260/280 ratio indicate RNA purity and the 260/230 value corresponds to protein contamination_
| 260/280 ratio | 260/230 ratio | ||||
|---|---|---|---|---|---|
| Fixation | Shoot | Root | Shoot | Root | |
| 70% EtOH | slow | 2.11 ± 0.02 | 2.10 ± 0.02 | 1.81 ± 0.02 | 1.81 ± 0.02 |
| fast | 2.10 ± 0.02 | 2.11 ± 0.01 | 1.80 ± 0.07 | 1.84 ± 0.02 | |
| RNAlater® | slow | 2.10 ± 0.01 | 2.13 ± 0.02 | 1.81 ± 0.04 | 1.84 ± 0.05 |
| fast | 2.11 ± 0.02 | 2.07 ± 0.01 | 1.82 ± 0.03 | 1.86 ± 0.05 | |
qPCR conditions of gene models, their accession numbers, primers, annealing temperatures, amplicon size, and qPCR efficiency used for the evaluation of slow and fast fixation_ Position refers to the relative distance R of the amplicon center from the 3' end of the coding data sequence (R=[d3′-Ac]/CDS); (i_e_, 0≡3′, 100≡5′)_
| Gene (accession #) | Direction | Sequence | ® (C) | Amplicon size (bp)* | Efficiency % | Position %CDS |
|---|---|---|---|---|---|---|
| ACT7 | Forward | AGCTTCGTGTTGCACCTGAA | 52 | 79 | 104 | 73 |
| (AT5G09810.1) | Reverse | ACATGGCAGGGACATTGAAAG | 52 | |||
| SUS | Forward | GTTCAACATTGTCTCTCCTGG | 52 | 53 | 103 | 41 |
| (AT5G20830.1) | Reverse | GCTGTAGATGAGCTCCTCGAT | 54 | |||
| UBQ1 | Forward | GGAGAGCAGTGACACCATCGA | 56 | 78 | 104 | 67 |
| (Z24738.1) | Reverse | GCCAAGGTACGACCATCTTCA | 54 | |||
| COX1 | Forward | GTTCCGATTCTGATAGGTGCAC | 55 | 116 | 103 | 80 |
| (AY300014.1) | Reverse | CCTACTTCTACTAAGGCTGAGC | 55 | |||
| HSP70 | Forward | GTCATCACTGTGCCTGCTTACT | 55 | 101 | 99 | 67 |
| (NM_118561.2) | Reverse | CATAAGCCAATGAAGCAGCTGTG | 55 | |||
| HSP90 | Forward | AAGGTGACACTGCTAAGCTTGA | 53 | 96 | 104 | 82 |
| (AT4G24190.1) | Reverse | CTTCCTTGGTCATACCAATACC | 53 | |||