Have a personal or library account? Click to login
Beware of Fixation—It Might Affect Your Experiments Cover

Beware of Fixation—It Might Affect Your Experiments

Open Access
|Jul 2020

Figures & Tables

Figure 1

Seed cassettes used for the germination of Brassica rapa. This hardware was part of the experiment “Magnetophoretic Induction of Curvature in Roots” that flew on Space-X3. The base (bottom) secures the top half of the cassette with peg and nylon screw. Seeds were germinated between ‘germination paper’ (not shown), such that seeds were positioned in one of the grooves. Germination was initiated by adding water through a port (arrow) on the base.
Seed cassettes used for the germination of Brassica rapa. This hardware was part of the experiment “Magnetophoretic Induction of Curvature in Roots” that flew on Space-X3. The base (bottom) secures the top half of the cassette with peg and nylon screw. Seeds were germinated between ‘germination paper’ (not shown), such that seeds were positioned in one of the grooves. Germination was initiated by adding water through a port (arrow) on the base.

Figure 2

RNA yield of 70% ethanol or RNAlater®-fixed-root or shoot tissue from two-day-old Brassica rapa seedlings that was submersed in fixative gradually (slow fixation), or submersed immediately (fast fixation); details are described in Material and Methods.
RNA yield of 70% ethanol or RNAlater®-fixed-root or shoot tissue from two-day-old Brassica rapa seedlings that was submersed in fixative gradually (slow fixation), or submersed immediately (fast fixation); details are described in Material and Methods.

Figure 3A

Electropherogram of total RNA extracted from two-day-old Brassica rapa tissue after RNAlater® fixative was added gradually (slow fixation), or the tissue was immersed completely (fast fixation).
Electropherogram of total RNA extracted from two-day-old Brassica rapa tissue after RNAlater® fixative was added gradually (slow fixation), or the tissue was immersed completely (fast fixation).

Figure 3B

Electropherogram of total RNA extracted from two-day-old Brassica rapa tissue after 70% ethanol fixative was added gradually (slow fixation), or the tissue was immersed completely (fast fixation).
Electropherogram of total RNA extracted from two-day-old Brassica rapa tissue after 70% ethanol fixative was added gradually (slow fixation), or the tissue was immersed completely (fast fixation).

Figure 4

Comparison of gene transcriptions in Brassica rapa roots after fixation in 70% ethanol or RNAlater®. The relative transcription levels were normalized to slow ethanol fixation of roots (i.e., set to ‘1’) because this normalization resulted in the lowest dynamic range of all possible tissue/fixation combinations.
Comparison of gene transcriptions in Brassica rapa roots after fixation in 70% ethanol or RNAlater®. The relative transcription levels were normalized to slow ethanol fixation of roots (i.e., set to ‘1’) because this normalization resulted in the lowest dynamic range of all possible tissue/fixation combinations.

Overall transcription levels for 70% ethanol and RNAlater®-fixed roots and shoots of two-day-old Brassica rapa seedlings_ The values represent the average fold-ratio of examined genes (ACT7, SUS, UBQ1, COX1, Hsp70, and Hsp90) between columns (stress/slow fixation) and rows (immediate, complete submersion in the respective fixative)_

EtOHSlow fixation
RootShoot
Fast fixationRoot1.0
Shoot1.6
  RNAlater®
Root5.0
Shoot2.5

Absorbance ratios for RNA extractions of samples extracted by Qiagen RNeasy Plant Mini Kit_ The 260/280 ratio indicate RNA purity and the 260/230 value corresponds to protein contamination_

260/280 ratio260/230 ratio
FixationShootRootShootRoot
70% EtOHslow2.11 ± 0.022.10 ± 0.021.81 ± 0.021.81 ± 0.02
fast2.10 ± 0.022.11 ± 0.011.80 ± 0.071.84 ± 0.02
RNAlater®slow2.10 ± 0.012.13 ± 0.021.81 ± 0.041.84 ± 0.05
fast2.11 ± 0.022.07 ± 0.011.82 ± 0.031.86 ± 0.05

qPCR conditions of gene models, their accession numbers, primers, annealing temperatures, amplicon size, and qPCR efficiency used for the evaluation of slow and fast fixation_ Position refers to the relative distance R of the amplicon center from the 3' end of the coding data sequence (R=[d3′-Ac]/CDS); (i_e_, 0≡3′, 100≡5′)_

Gene (accession #)DirectionSequence® (C)Amplicon size (bp)*Efficiency %Position %CDS
ACT7ForwardAGCTTCGTGTTGCACCTGAA527910473
(AT5G09810.1)ReverseACATGGCAGGGACATTGAAAG52
SUSForwardGTTCAACATTGTCTCTCCTGG525310341
(AT5G20830.1)ReverseGCTGTAGATGAGCTCCTCGAT54
UBQ1ForwardGGAGAGCAGTGACACCATCGA567810467
(Z24738.1)ReverseGCCAAGGTACGACCATCTTCA54
COX1ForwardGTTCCGATTCTGATAGGTGCAC5511610380
(AY300014.1)ReverseCCTACTTCTACTAAGGCTGAGC55
HSP70ForwardGTCATCACTGTGCCTGCTTACT551019967
(NM_118561.2)ReverseCATAAGCCAATGAAGCAGCTGTG55
HSP90ForwardAAGGTGACACTGCTAAGCTTGA539610482
(AT4G24190.1)ReverseCTTCCTTGGTCATACCAATACC53
Language: English
Page range: 47 - 57
Published on: Jul 18, 2020
Published by: American Society for Gravitational and Space Research
In partnership with: Paradigm Publishing Services
Publication frequency: 2 issues per year

© 2020 Myoung-Ryoul Park, Karl H. Hasenstein, published by American Society for Gravitational and Space Research
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.