Molecular characterisation of cornelian cherry (Cornus mas L.) genotypes

SSR markers	Primer sequence (5′ → 3′)	A repetitive pattern
CM007	R:tccagggaatgttcggtagattag L:gtttaggtgtgagtgcagatgg	(GT)24
CM008	L:tcgttaatgtgaaattggaacg R:caccgtacacgcaaagtcc	(GT)11
CM010	L:gctagcagaagcacagttagcc R:tccaacatgtaaaacctagatgc	(CA)12
CM026	L:gaattcatgtaatgttgttgtctgc R:cctgcatataattcaggtaaagagc	(CA)14
CM031	L:taccctctcttgctctttgtcc R:aaacaatcaaacccaaacaacc	(AG)26(TG)13
CM037	L:aacacagagaaacacgtgcaa R:tggagatctttgaagaacagga	(TG)20
CM039	L:gggtattgtaatcaatgtaaaaccaa R:tcacaccaccagcaatcact	(GT)18
CM043	L:gtccacacctgttgttcagc R:ggttgcaatgctttcttgg	(TG)16(TA)5

1 SSR, simple sequence repeat.

Table 2.

Proportion of components used in PCR reaction mix 1 and mix 2.

Mix 1		Mix 2
Components	Reaction concentration	Components	Reaction concentration
CM007	0.1 μM	CM031	0.2 μM
CM008	0.2 μM	CM037	0.2 μM
CM010	0.1 μM	CM039	0.2 μM
CM026	0.1 μM	CM043	0.2 μM
dNTP	0.2 mM	dNTP	0.2 mM
PCR buffer	1×	PCR buffer	1×
MgCl₂	2.5 mM	MgCl₂	2.5 mM
Taq pol.	0.2 U · μL^-1	Taq pol.	0.2 U · μL^-1
DNA	10 ng	DNA	10 ng
ddH₂O	to 15 μL	ddH₂O	to 15 μL

Table 3.

PCR protocol temperature regime for two separate PCR reactions (mix 1 and mix 2).

Protocol
	Temperature (°C)	Duration (min:s)	Number of cycles
Enzyme activation	95	5:00
Denaturation	94	0:40
Annealing	52	0:40	35
Elongation	72	0:30
Final elongation	72	4:00

Table 4.

Parameters of heterozygosity.

Populations	Locus	Na	Ne	R	P (R)	Ho	He	F
Drvar	CM007	10.000	7.339	0.735	0.1979	0.950	0.864	-0.100
	CM008	9.000	5.517	0.614	0.1311	0.550	0.819	0.328
	CM010	9.000	6.723	0.746	0.2046	0.550	0.851	0.354
	CM026	7.000	3.846	0.549	0.1	0.650	0.740	0.122
	CM031	11.000	4.938	0.45	0.059	0.600	0.798	0.248
	CM037	9.000	4.348	0.483	0.0717	0.800	0.770	-0.039
	CM039	8.000	5.298	0.661	0.1556	0.850	0.811	-0.048
	CM043	6.000	4.145	0.692	0.1727	0.700	0.759	0.077
Mostar	CM007	13.000	7.339	0.566	0.1078	0.950	0.864	-0.100
	CM008	11.000	8.000	0.727	0.1931	0.750	0.875	0.143
	CM010	14.000	9.877	0.707	0.1813	0.850	0.899	0.054
	CM026	7.000	4.571	0.652	0.1508	0.750	0.781	0.040
	CM031	8.000	5.063	0.634	0.1413	0.800	0.803	0.003
	CM037	11.000	5.594	0.508	0.082	0.850	0.821	-0.035
	CM039	8.000	5.298	0.661	0.1556	0.700	0.811	0.137
	CM043	7.000	4.651	0.664	0.1572	0.650	0.785	0.172
Zenica	CM007	10.000	8.602	0.862	0.2857	1.000	0.884	-0.132
	CM008	8.000	3.687	0.461	0.0631	0.750	0.729	-0.029
	CM010	10.000	7.843	0.787	0.2309	0.800	0.873	0.083
	CM026	5.000	4.188	0.837	0.2663	0.550	0.761	0.278
	CM031	11.000	4.790	0.435	0.0535	0.850	0.791	-0.074
	CM037	7.000	4.469	0.638	0.1434	0.900	0.776	-0.159
	CM039	6.000	3.448	0.575	0.112	0.850	0.710	-0.197
	CM043	4.000	2.067	0.516	0.0854	0.400	0.516	0.225
Average (Drvar)		8.625	5.269	0.584	0.1163	0.706	0.801	0.118
Average (Mostar)		9.875	6.299	0.595	0.1217	0.788	0.830	0.052
Average (Zenica)		7.625	4.887	0.535	0.0937	0.763	0.755	-0.001
Average (Total)		8.708	5.485	0.561	0.1055	0.752	0.795	0.056

1 F, intragroup inbreeding; He, expected heterozygosity; Ho, observed heterozygosity; Na, number of detected alleles; No, effective number of alleles; P (R), p-value of the ratio of the detected and effective number of alleles; R, ratio of detected and effective number of alleles.

Table 5.

Deviation of eight examined SSR loci from HW equilibrium in the total set samples.

Population	Locus	SS	χ²	p-value	Significance
Drvar	CM007	45	63.942	0.033	*
Drvar	CM008	36	71.652	0.000	***
Drvar	CM010	36	76.893	0.000	***
Drvar	CM026	21	14.129	0.864	ns
Drvar	CM031	55	61.856	0.245	ns
Drvar	CM037	36	27.500	0.845	ns
Drvar	CM039	28	58.890	0.001	***
Drvar	CM043	15	14.860	0.462	ns
Mostar	CM007	78	90.510	0.157	ns
Mostar	CM008	55	75.422	0.035	*
Mostar	CM010	91	104.822	0.153	ns
Mostar	CM026	21	22.016	0.399	ns
Mostar	CM031	28	28.657	0.430	ns
Mostar	CM037	55	56.788	0.408	ns
Mostar	CM039	28	69.540	0.000	***
Mostar	CM043	21	18.345	0.627	ns
Zenica	CM007	45	48.200	0.345	ns
Zenica	CM008	28	10.674	0.999	ns
Zenica	CM010	45	55.142	0.143	ns
Zenica	CM026	10	15.985	0.100	ns
Zenica	CM031	55	41.147	0.917	ns
Zenica	CM037	21	15.396	0.803	ns
Zenica	CM039	15	78.395	0.000	***
Zenica	CM043	6	5.235	0.514	ns

1 HW, Hardy–Weinberg; ns, there is no statistically significant deviation from HWE; SS: sum of squares; SSR, simple sequence repeat.

1* p < 0.05.

1** p < 0.01.

1*** p < 0.001.

Results of PCoA analysis of individual cornelian cherry genotypes. PCoA, Principal coordinate analysis.

Table 6.

AMOVA.

Source	df	SS	MS	Estimated Var.	%
Among Pops	2	16.650	8.325	0.120	3
Among Indiv.	57	201.300	3.532	0.262	8
Within Indiv.	60	180.500	3.008	3.008	89
Total	119	398.450	3.390	100

1 AMOVA, analysis of molecular variance; df, degree of freedom; MS: mean squares; SS: sum of squares; Var: estimated variance component.

1 %: percentage of genetic variation.

Table 7.

Results of F statistical analysis.

Locus	F_IS	F_IT	F_ST
CM007	-0.111	-0.086	0.022
CM008	0.154	0.201	0.056
CM010	0.161	0.191	0.036
CM026	0.146	0.189	0.051
CM031	0.059	0.083	0.025
CM037	-0.077	-0.052	0.023
CM039	-0.029	0.012	0.040
CM043	0.150	0.224	0.086
Average	0.057	0.095	0.042

NJ dendrogram of the cornelian cherry genotypes based on the results of the interindividual genetic distance analysis. The codes of the genotypes are: D1,2,3,…(Drvar1,2,3,…); M1,2,3,…(Mostar1,2,3,…); Z1,2,3,… (Zenica1,2,3,…). NJ, Neighbour-Joining.

References

Authors

Metrics

Articles in this issue

DOI: https://doi.org/10.2478/fhort-2024-0013 | Journal eISSN: 2083-5965 | Journal ISSN: 0867-1761

Journal RSS Feed

Language: English

Page range: 211 - 219

Submitted on: Apr 3, 2024

Accepted on: May 28, 2024

Published on: Jul 4, 2024

Published by: Polish Society for Horticultural Sciences (PSHS)

In partnership with: Paradigm Publishing Services

Publication frequency: 2 issues per year

Keywords:

molecular characterisation

Related subjects:

Life sciences,

Plant science

© 2024 Azra Skender, Gordana Ðurić, Amine Assouguem, Sezai Ercisli, Gulce Ilhan, Rachid Lahlali, Riaz Ullah, Zafar Iqbal, Ahmed Bari, published by Polish Society for Horticultural Sciences (PSHS)
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Volume 36 (2024): Issue 2 (October 2024)

Molecular characterisation of cornelian cherry (Cornus mas L.) genotypes

Figures & Tables

Table 1.

Table 2.

Table 3.

Table 4.

Table 5.

Figure 1.

Table 6.

Table 7.

Figure 2.

Paradigm

My account