Analysis of the genetic diversity and population structures of black locust (Robinia pseudoacacia L.) stands in Poland based on simple sequence repeat markers

Figures & Tables

Locus	Na	Ho	uHe	FIS
Rops15	20	0.968	0.716	−0.378
Rops16	19	0.677	0.555	−0.252
Rops18	6	0.051	0.063	0.121

Forest stands	Ho	He	H	F
Cybinka	0.445	0.291	0.295	−0.310
Krosno232	0.600	0.469	0.473	0.076
Krosno90	0.620	0.353	0.358	−0.757
Miechów	0.67	0.373	0.380	−0.820
Pińczów	0.552	0.632	0.663	0.068
Strzelce	0.472	0.446	0.453	−0.060
Wołów	0.623	0.456	0.472	−0.306
Oborniki Śl.	0.44	0.49	0.501	0.145
Buckow	0.67	0.40	0.406	−0.663
Total	0.56	0.433	0.445	−0.260

Source	df	SS	MS	Est. var.	%
Among pops	8	88.163	11.020	0.335	37
Within pops	275	157.488	0.573	0.573	63
Total	283	245.651		0.908	100

No.	Forestry division	Area (ha)	Tree age (years)	Geographical coordinates
1	Cybinka (PL)	1.05	72	N 52 7 23.7 E 14 56 43.5
2	Krosno 232 (PL)	3.18	92	N 52 8 24.1 E 14 55 14.3
3	Krosno 90 (PL)	1.14	39	N 52 5 40.2 E 14 58 13.7
4	Mieszkowice (PL)	1.31	50	N 52 51 31.5 E 14 11 40.7
5	Pińczów (PL)	3.19	38	N 50 15 53.0 E 20 42 7.2
6	Strzelce (PL)	1.36	40	N 50 29 37.7 E 18 2 54.2
7	Wołów (PL)	2.86	46	N 51 25 12.5
8	Oborniki Śląskie (HU)	1.09	15	N 51 22 39.5 E 16 53 23.7
9	Buckow (DE)	1.10	58	N 52 33 32.8

Nuclear microsatellite loci used in the analysis of genetic diversity of R_ pseudoacacia

Locus	Repeat	Primer sequence (5′–3′)	Ta. (°C)	Size range (bp)	No. of alleles	GenBank NCBI accession no.
Rops15	(CT)20	GCCCATTTTCAAGAATCCATATATTGG	54	112–254	43	AB120731
Rops15	(CT)20	TCATCCTTGTTTTGGACAATC	54	112–254	43	AB120731
Rops16	(CT)13	AACCCTAAAAGCCTCGTTATC	56	195–223	15	AB120732
Rops16	(CT)13	TGGCATTTTTTGGAAGACACC	56	195–223	15	AB120732
Rops18	(AC)8	AGATAAGATCAAGTGCAAGAGTGTAAG	54	135–219	13	AB120733
Rops18	(AC)8	TAATCCTCGAGGGAACAATAC	54	135–219	13	AB120733