Analysis of the genetic diversity and population structures of black locust (Robinia pseudoacacia L.) stands in Poland based on simple sequence repeat markers

No.	Forestry division	Area (ha)	Tree age (years)	Geographical coordinates
1	Cybinka (PL)	1.05	72	N 52 7 23.7 E 14 56 43.5
2	Krosno 232 (PL)	3.18	92	N 52 8 24.1 E 14 55 14.3
3	Krosno 90 (PL)	1.14	39	N 52 5 40.2 E 14 58 13.7
4	Mieszkowice (PL)	1.31	50	N 52 51 31.5 E 14 11 40.7
5	Pińczów (PL)	3.19	38	N 50 15 53.0 E 20 42 7.2
6	Strzelce (PL)	1.36	40	N 50 29 37.7 E 18 2 54.2
7	Wołów (PL)	2.86	46	N 51 25 12.5
8	Oborniki Śląskie (HU)	1.09	15	N 51 22 39.5 E 16 53 23.7
9	Buckow (DE)	1.10	58	N 52 33 32.8

Table 2.

Nuclear microsatellite loci used in the analysis of genetic diversity of R. pseudoacacia

Locus	Repeat	Primer sequence (5′–3′)	Ta. (°C)	Size range (bp)	No. of alleles	GenBank NCBI accession no.
Rops15	(CT)20	GCCCATTTTCAAGAATCCATATATTGG	54	112–254	43	AB120731
Rops15	(CT)20	TCATCCTTGTTTTGGACAATC	54	112–254	43	AB120731
Rops16	(CT)13	AACCCTAAAAGCCTCGTTATC	56	195–223	15	AB120732
Rops16	(CT)13	TGGCATTTTTTGGAAGACACC	56	195–223	15	AB120732
Rops18	(AC)8	AGATAAGATCAAGTGCAAGAGTGTAAG	54	135–219	13	AB120733
Rops18	(AC)8	TAATCCTCGAGGGAACAATAC	54	135–219	13	AB120733

Table 3.

The genetic diversity indexes for each locus

Locus	Na	Ho	uHe	FIS
Rops15	20	0.968	0.716	−0.378
Rops16	19	0.677	0.555	−0.252
Rops18	6	0.051	0.063	0.121

[i] Na – number of alleles; Ho – observed heterozygosity; uHe – unbiased genetic diversity; FIS – inbreeding coefficient.

Table 4.

Genetic diversity of populations of R. pseudoacacia revealed by microsatellite loci

Forest stands	Ho	He	H	F
Cybinka	0.445	0.291	0.295	−0.310
Krosno232	0.600	0.469	0.473	0.076
Krosno90	0.620	0.353	0.358	−0.757
Miechów	0.67	0.373	0.380	−0.820
Pińczów	0.552	0.632	0.663	0.068
Strzelce	0.472	0.446	0.453	−0.060
Wołów	0.623	0.456	0.472	−0.306
Oborniki Śl.	0.44	0.49	0.501	0.145
Buckow	0.67	0.40	0.406	−0.663
Total	0.56	0.433	0.445	−0.260

[i] He – average expected heterozygosity; H – heterozygosity; Ho – observed heterozygosity; F – fixation index

Allelic patterns for *R. pseudoacacia* populations. Na – number of alleles per locus, Ne – number of effective alleles, I – Shannon's information index

Table 5.

The mean FIS and FIT values for population of R. pseudoacacia

F-statistics	Value	P
FST	0.412	0.001
FIS	−0.170	0.649
FIT	0.246	0.001
Nm	0.771

Table. 6

Analysis of molecular variance (AMOVA) of genetic diversity of R. pseudoacacia populations

Source	df	SS	MS	Est. var.	%
Among pops	8	88.163	11.020	0.335	37
Within pops	275	157.488	0.573	0.573	63
Total	283	245.651		0.908	100

[i] df – degrees of freedom; SS – sum of squares; MS – mean square; est. var. – estimated variance.

Relationships among the populations of *Robinia pseudoacacia*. A principal coordinate analysis (PCoA) based on pairwise genetic distance estimates for all populations. Percentages of total variance explained by coordinates 1 and 2 accounting for 68.99 and 14.23%, respectively

References

Authors

Metrics

Articles in this issue

DOI: https://doi.org/10.2478/ffp-2023-0019 | Journal eISSN: 2199-5907 | Journal ISSN: 0071-6677

Journal RSS Feed

Language: English

Page range: 187 - 198

Submitted on: Jun 28, 2023

Accepted on: Oct 26, 2023

Published on: Dec 12, 2023

Published by: Forest Research Institute

In partnership with: Paradigm Publishing Services

Keywords:

Robinia pseudoacacia,

non-native tree species,

secondary distribution,

Related subjects:

© 2023 Iwona Szyp-Borowska, Anna Zawadzka, Tomasz Wojda, Marcin Klisz, published by Forest Research Institute
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Volume 65 (2023): Issue 4 (December 2023)

Analysis of the genetic diversity and population structures of black locust (Robinia pseudoacacia L.) stands in Poland based on simple sequence repeat markers

Figures & Tables

Table 1.

Table 2.

Table 3.

Table 4.

Figure 1.

Table 5.

Table. 6

Figure 2.

Paradigm

My account