Skip to main content
Have a personal or library account? Click to login
A Novel 4.2 kb deletion of the 3′UTR of RUNX2 Gene Causes Cleidocranial Dysplasia: Further Delineation of the Role of yhe 3′UTR Cover

A Novel 4.2 kb deletion of the 3′UTR of RUNX2 Gene Causes Cleidocranial Dysplasia: Further Delineation of the Role of yhe 3′UTR

Open Access
|May 2026

Figures & Tables

Table 1.

Performed genetic analyses and obtained results

AnalysisMethodsResultVariant and ExplanationType and Classification
1.chromosomal microarrayAgilent platform, Human CGH array kit 8x60Knegative//
2.whole exome sequencing (WES)Illumina platform, average coverage depth of ≤20x, in-house bioinformatics pipeline, read alignment to the GRCh37/hg19negative with secondary findingscarriership findings: heterozygous variant in BTD, FTCD and POLR3A genes/
3.whole genome sequencing (WGS)Illumina platform, average coverage depth of ~30×, in-house bioinformatics pipeline, read alignment to the GRCh37/hg19, SNVs/indels and CNVs called using DRAGEN and Mantapotentially relevant6p21.1 deletion, ~4.2 kb (3′UTR of RUNX2), transcript: NM_001015051.3, genomic coordinates: chr6:45518143-45522390loss, uncertain significance (class 3)
4.trio high resolution chromosomal microarrayAgilent platform, Human CGH array kit 4x180K+SNPinconclusiveonly one probe in this region with log2 ratio −1.3 in proband and log2 ratio ~0 in parents/
5.trio custom-designed qPCR assay for RUNX2 geneqPCR assay using four sets of primers for RUNX2 gene: first in exon 2, second in exon 8/3′UTR, third within the 3′UTR itself and fourth downstream of the 3′UTRpositivedeletion of the regions flanked by third and fourth pair of primers, de novo originloss, likely pathogenic (class 2)
Figure 1.

qPCR results showing the copy number variants in the 3′UTR and the downstream region of RUNX2 gene, compared to the F8 gene in the proband (daughter) and her parents. Legend: To ensure quality control, we conducted a sex determination for the subjects by assessing the copy number of the Factor VIII (F8) gene in relation to the two-copy autosomal reference gene ALB. The father has one copy of the F8 gene, while both the mother and daughter have two copies, as expected. Conversely, the daughter has only one copy of both the 3′UTR (P1 amplicon) and the downstream region of RUNX2 gene (P2 amplicon), whereas parents have two copies. Results for RUNX2 exons 2 and the junction of exon 8/3′UTR, which serve as additional controls, are not included in the figure, as all three samples showed normal two copies. This further demonstrates that the deletion in our patient does not affect the last exon and the junction with 3′UTR region of RUNX2 gene.

Table 2.

Custom-designed primers for the detection of the copy number of RUNX2 3′ UTR and the downstream region

GeneForward primer - sequence (genomic coordinates GRCh37)Reverse primer - sequenceAmplicon size
RUNX2-3′-UTR5′ TCTGAATGCTTGGGCTCACC 3′ (starts at chr6:45519587)5′ACTCTCCCTGTGATGTGGGT 3′103 bp
RUNX2-3′-UTR+5′CCTGAGCTGTCCAGGTAT TGG 3′ (starts at chr6:45521163)5′CGAGAAGGGTTGGGAGCAAT3′93 bp
DOI: https://doi.org/10.2478/bjmg-2025-00026 | Journal eISSN: 2199-5761 (formerly 1311-0160) | Journal ISSN: 1311-0160
Language: English
Page range: 107 - 112
Published on: May 14, 2026
Published by: Macedonian Academy of Sciences and Arts
In partnership with: Paradigm Publishing Services

© 2026 M Mijovic, G Cuturilo, J Ruml Stojanovic, M Brankovic, A Miletic, B Bosankic, M Dedovic, D Perovic, N Maksimovic, T Damnjanovic, published by Macedonian Academy of Sciences and Arts
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.