Figure 1.
Custom-designed primers for the detection of the copy number of RUNX2 3′ UTR and the downstream region
| Gene | Forward primer - sequence (genomic coordinates GRCh37) | Reverse primer - sequence | Amplicon size |
|---|---|---|---|
| RUNX2-3′-UTR | 5′ TCTGAATGCTTGGGCTCACC 3′ (starts at chr6:45519587) | 5′ACTCTCCCTGTGATGTGGGT 3′ | 103 bp |
| RUNX2-3′-UTR+ | 5′CCTGAGCTGTCCAGGTAT TGG 3′ (starts at chr6:45521163) | 5′CGAGAAGGGTTGGGAGCAAT3′ | 93 bp |
Performed genetic analyses and obtained results
| Analysis | Methods | Result | Variant and Explanation | Type and Classification | |
|---|---|---|---|---|---|
| 1. | chromosomal microarray | Agilent platform, Human CGH array kit 8x60K | negative | / | / |
| 2. | whole exome sequencing (WES) | Illumina platform, average coverage depth of ≤20x, in-house bioinformatics pipeline, read alignment to the GRCh37/hg19 | negative with secondary findings | carriership findings: heterozygous variant in BTD, FTCD and POLR3A genes | / |
| 3. | whole genome sequencing (WGS) | Illumina platform, average coverage depth of ~30×, in-house bioinformatics pipeline, read alignment to the GRCh37/hg19, SNVs/indels and CNVs called using DRAGEN and Manta | potentially relevant | 6p21.1 deletion, ~4.2 kb (3′UTR of RUNX2), transcript: NM_001015051.3, genomic coordinates: chr6:45518143-45522390 | loss, uncertain significance (class 3) |
| 4. | trio high resolution chromosomal microarray | Agilent platform, Human CGH array kit 4x180K+SNP | inconclusive | only one probe in this region with log2 ratio −1.3 in proband and log2 ratio ~0 in parents | / |
| 5. | trio custom-designed qPCR assay for RUNX2 gene | qPCR assay using four sets of primers for RUNX2 gene: first in exon 2, second in exon 8/3′UTR, third within the 3′UTR itself and fourth downstream of the 3′UTR | positive | deletion of the regions flanked by third and fourth pair of primers, de novo origin | loss, likely pathogenic (class 2) |