Skip to main content
Have a personal or library account? Click to login
Impact of Cholecystectomy on Gastric Mucosal c-MYC and h-TERT Expression; A Potential Link to Gastric Cancer Development Cover

Impact of Cholecystectomy on Gastric Mucosal c-MYC and h-TERT Expression; A Potential Link to Gastric Cancer Development

Open Access
|May 2026

Figures & Tables

Table 1.

Specific Primer Sequences Used for mRNA Expression Analysis of c-MYC, hTERT, and β-Actin (5′→3′)

ACTB
  Primer setsACCAGGGCGTGATGGT (Forward)
CGTCCCAGTTGGTGACG (Reverse)
c-MYC
  Primer setsCCTGGTGCTCCATGAGG (Forward)
CCAGACTCTGACCTTTTGCC (Reverse)
hTERT
  Primer setsGCCGATTGTGAACATGGAC (Forward)
CGTAGTTGAGCACGCTGAA (Reverse)
Table 2.

Demographic Characteristics of Participants by Group

Gastric CancerCholecystectomyControl
Mean Age65,2 ± 10,160,5 ± 9,259,9 ± 13,5
GenderFemale n (%)16 (%50)22 (%64)23 (%67)
Male n (%)16 (%50)12 (%36)11 (%33)
Table 3.

Comparison of H. pylori Infection and Intestinal Metaplasia Across Study Groups

Groupsp-value
Control (n=34)Cholecystectomy (CK) (n=34)Gastric Cancer (CA) (CA) (n=32)
H.pylori
Negative15 (%44,1)17 (%50,0)13 (%40,6)0,740
Positive19 (%55,9)17 (%50,0)19 (%59,4)
Intestinal Metaplasia
Negative20 (%58,8)26 (%76,5)-0,120
Positive14 (%41,2)8 (%23,5)
Figure 1.

Relative expressions of c-MYC and hTERT mRNA

DOI: https://doi.org/10.2478/bjmg-2025-00021 | Journal eISSN: 2199-5761 (formerly 1311-0160) | Journal ISSN: 1311-0160
Language: English
Page range: 57 - 64
Published on: May 14, 2026
Published by: Macedonian Academy of Sciences and Arts
In partnership with: Paradigm Publishing Services

© 2026 E Kasap, S Sabah Özcan, L Elmas, F Seher Ozalp Ates, M Korkmaz, published by Macedonian Academy of Sciences and Arts
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.