Introduction
Multiple Sclerosis (MS) is a chronic inflammatory disease which leads to demyelination and neurodegeneration of the central nervous system(CNS) [1, 2]. The disease generally affects young adults and causes serious neurological disabilities [3, 4]. Focal demyelination, inflammation, scar formation, and various axonal degeneration are involved in the pathology of MS lesions [4, 5, 6]. Axonal degeneration is the main reason for this non-reversible disability in MS patients [7]. While the etiology of MS is not fully understood, environmental, genetic, and geographical factors may play a part [7, 8, 9]. Specific environmental/metabolic factors including, Epstein Barr virus, seasonality in MS patients’ birth, sun exposure, vitamin D levels, and cigarettes have been shown to influence epidemiologic patterns in MS [10, 11]. The differences in susceptibility to MS, despite the same environmental exposures, indicates the involvement of genetic factors in the development of pathogenesis [7]. In recent years, genetic studies suggest that a single susceptible locus is not sufficient to lead to MS and that MS is a heterogeneous disease [12, 13]. Therefore, it is likely that multiple gene mutations are needed to contribute additively to the course of this disease [14]. In major gene regions, most of the loci associated with MS susceptibility are located at the major histocompatibility complex (MHC) which is also called the HLA-DRB1*15 haplotype. The promoter region of HLA-DRB1 gene contains a vitamin D response element (VDRE) which is important for gene expression of HLA-DRB1. Variants in the vitamin D receptor (VDR) gene affect MS susceptibility by the way of changing the interaction of VDRE on the MHC regulatory region [15]. Thus, vitamin D may play an important role in developing MS. Furthermore, vitamin D has been shown to impact immunomodulation in the MS pathogenesis [11, 16, 17]. The usage of the active form of vitamin D in experimental MS and experimental autoimmune encephalomyelitis (EAE) animal studies was shown to be beneficial [11, 18, 19]. Additionally, studies in mice indicate that the VDR gene has a critical role in EAE activity [20]. These findings suggest that VDR and its ligand have immunosuppressive and anti-inflammatory properties which afect MS susceptibility [1, 21]. Finally, there is an inverse correlation between vitamin D blood levels and MS prevalence [11]. Taken together, these studies indicate that vitamin D (or lack thereof) may play an important role in the development of MS.
In addition to vitamin D, the vitamin D receptor (VDR) is hypothesized as playing a role in MS; however, this is a controversial topic. Various single nucleotide polymorphisms (SNP) including Apa-I (rs7975232), Bsm-I (rs1544410), Fok-I (rs2228570), and Taq-I (rs731236) in the VDR gene have been investigated for MS susceptibility, and are they thought to be associated with the MS disease [7, 21]. However, these results are inconclusive and there is disagreement among these findings [7, 22]. Several studies indicate that the VDR gene polymorphisms are associated with susceptibility to MS [23, 24, 25]. Furthermore, these polymorphisms in the VDR gene may change the vitamin D serum levels, vitamin D structure, and function as such with an immune modulatory effect; these are the mechanisms of the vitamin D and VDR complex [22]. By contrast, several studies suggest that these polymorphisms are not associated with MS as indicated by VDR-mRNA expression or active vitamin D induced target gene expression [7, 26].
Since there is disagreement in the literature, the aim of the current study was to investigate the relationship between the VDR Fok-I (rs2228570) T/C, Bsm-I (rs1544410) G/A, Taq-I (rs731236) T/C polymorphisms and MS disease in the Turkish population.
Material and methods
Patients and controls
A total of 474 ethnically matched participants from the Turkish population were enrolled in the study. Of the 474 participants, 271 were diagnosed with MS. Within the MS patients 2 of them had Primary Progressive Multiple Sclerosis (PPMS), 184 of them had Relapsing Remitting Multiple Sclerosis (RRMS) and 85 of them had Secondary Progressive Multiple Sclerosis (SPMS). 203 individuals served as healthy controls. All patients were referred to Goztepe Training and Research Hospital and were clinically diagnosed with MS, according to the McDonald’s criteria [27]. A blood sample was collected from each person in order to obtain genomic DNA. The study protocol and consent were approved by Marmara University Medical School Clinical Research Ethic Committee. Written informed consent was obtained from all of the participants and there was no patient or control younger than the age of 16 in the study.
Genotyping of polymorphisms
Genomic DNA was extracted by using the salting out method, as previously described [28]. Polymorphism regions Fok-I (rs2225870), Bsm-I (rs1544410) and Taq-I (rs731236) were amplified by a polymerase chain reaction (PCR) (Techne Tc312) using specific primers, visible in Table 1. PCR was carried by a total volume of 25 μl reaction containing 0.5 μg of genomic DNA, 2.5 μl 10x bufer, 1.5 mM MgCl2, 0.5 μM forward primer, 0.5 μM reverse primer, 0.2 mM dNTP, and 0.5 U Taq polymerase. The PCR sample were denatured at 94°C for 3 min (1x) for initial denaturation and the main PCR cycle for denaturation is at 94°C for 30 secs, annealing at 69°C for 30 secs, extension at 72°C for 45 secs (all cycles 40x), and final extension was done at 72°C for 10 min (1x) (annealing 69°C for Fok-I, 66°C for Bsm-I and 68°C for Taq-I). The PCR products were digested by Fok-I, Bsm-I, and Taq-I restriction enzymes (CutSmart, New England Biolabs inc.). 10 μl of PCR product was mixed with 5 U restriction enzyme, 3 μl 10X reaction buffer and incubated overnight at 37°C for Fok-I, at 65°C for 3 hours for Bsm-I, at 65°C for 3 hours for Taq-I. The digested PCR products were run on 1.5% agarose gel electrophoreses and genotyping was determined based on fragment size of digested PCR products. Digestion of Fok-I gives C/C (343 bp for homozygote mutant), T/C (343 bp, 267 bp, 76 bp for heterozygote) and T/T (267 bp, 76 bp for homozygote wild type). The digestion of Bsm-I gives A/A (531 bp for homozygote mutant), G/A (531 bp, 329 bp, 202 bp for heterozygote) and G/G (329 bp, 202 bp for homozygote wild type). The digestion of Taq-I gives T/T (479 bp for homozygote wild type), C/T (479 bp, 294 bp, 185 bp for heterozygote) and C/C (294 bp, 185 bp for homozygote mutant).
Table 1
Primers used for amplification of polymorphism sites on the VDR gene.
| Polymorphism | Forward Primer | Reverse Primer |
|---|---|---|
| Fok-I (rs2228570) | AGGATGCCAGCTGGCCCTGGCAC | TGGCTGTGAGCGCCGCATGTTCCATG |
| Bsm-I (rs1544410) | TCCTTGAGCCTCCAGTCCAGG | GCAACCTGAAGGGAGACGTAGC |
| Taq-I (rs731236) | AGAGCATGGACAGGGAGCAAGGC | TAGCTTCATGCTGCACTCAGGCTGG |
Statistical analysis
Comparison of genotype or allele between MS and control or MS subtypes were determined by using Pearson’s chi-square test. The odds ratio and a 95% confidence interval were also used. Values of p<0.05 were considered significant. Data was analyzed with the SPSS 21.0 program. The statistical power of this study was calculated by using the G*Power program version of 3.1.9.6.
Results
VDR gene polymorphisms (Fok-I, Taq-I and Bsm-I) were determined in both MS and healthy people in the Turkish population. The distribution of the genotypes of Bsm-I, Fok-I, and Taq-I polymorphisms between MS/MS subtype group and control group are shown in Table 2a, Table 3a, and Table 4a, respectively. Chi-square tests were performed for the distribution of VDR gene polymorphisms across MS/MS subtype group and control group (Table 2a, Table 3a, Table 4a).
Table 2 a-b
Genotype distribution and allele frequency of VDR Bsm-I polymorphism in MS patients and healthy controls.
| a) | Bsm-I Genotype | |||||
|---|---|---|---|---|---|---|
| G/G | G/A | A/A | Total | p | Power (%) | |
| MS-Control | ||||||
| Control | 37.0% (n=75) | 46.3% (n=94) | 16.7% (n=34) | 100% (n=203) | 0.677 | |
| MS | 35.8% (n=97) | 44.3% (n=120) | 19.9% (n=54) | 100% (n=271) | 100 | |
| Total | 36.3% (n=172) | 45.1% (n=214) | 18.6% (n=88) | 100% (n=474) | ||
| MS subtypes | ||||||
| Control | 37.0% (n=75) | 46.3% (n=94) | 16.7% (n=34) | 100% (n=203) | ||
| RRMS | 35.9% (n=66) | 46.7% (n=86) | 17.4% (n=32) | 100% (n=184) | ||
| SPMS | 35.3% (n=30) | 38.8% (n=33) | 25.9% (n=22) | 100% (n=85) | 0.622 | 100 |
| PPMS | 50.0% (n=1) | 50.0% (n=1) | 0.0% (n=0) | 100% (n=2) | ||
| Total | 36.3% (n=172) | 45.1% (n=214) | 18.6% (n=88) | 100% (474) | ||
| b) | Bsm-I Allele | |||||
| G | A | Total | p | Power (%) | ||
| MS-Control | ||||||
| Control | 60.1% (n=244) | 39.9% (n=162) | 100% (n=406) | |||
| MS | 57.9% (n=314) | 42.1% (n=228) | 100% (n=542) | 0.503 | 100 | |
| Total | 58.9%(n=558) | 41.1% (n=390) | 100% (n=948) | |||
| MS subtypes | ||||||
| Control | 60.1% (n=244) | 39.9% (n=162) | 100% (n=406) | |||
| RRMS | 59.2% (n=218) | 40.8% (n=150) | 100% (n=368) | 0.589 | ||
| SPMS | 54.7% (n=93) | 45.3% (n=77) | 100% (n=170) | 100 | ||
| PPMS | 75.0% (n=3) | 25.0% (n=1) | 100% (n=4) | |||
| Total | 58.8% (n=558) | 41.2% (n=390) | 100% (n=948) | |||
Table 3 a-b
Genotype distribution and allele frequency of VDR Fok-I polymorphism in MS patients and healthy controls.
| a) | Fok-I Genotype | |||||
|---|---|---|---|---|---|---|
| T/T | T/C | C/C | Total | p | Power (%) | |
| MS-Control | ||||||
| Control | 13.3% (n=27) | 38.9% (n=79) | 47.8% (n=97) | 100%(n=203) | 0.037 | |
| MS | 22.5% (n=61) | 35.8% (n=97) | 41.7% (n=113) | 100%(n=271) | 100 | |
| Total | 18.6% (n=88) | 37.1% (n=176) | 44.3% (n=210) | 100%(n=474) | ||
| MS subtypes | ||||||
| Control | 13.3% (n=27) | 38.9% (n=79) | 47.8% (n=97) | 100%(n=203) | ||
| RRMS SPMS | 23.3% (n=43) 21.1% (n=18) | 33.2% (n=61) 42.4% (n=36) | 43.5% (n=80) 36.5% (n=31) | 100%(n=184) 100%(n=85) | 0.074 | 100 |
| PPMS | 0.0% (n=0) | 0.0% (n=0) | 100%.0 (n=2) | 100%(n=2) | ||
| Total | 18.6% (n=88) | 37.1% (n=176) | 44.3% (n=210) | 100%(n=474) | ||
| b) | Fok-I Allele | |||||
| T | C | Total | p | Power (%) | ||
| MS-Control | ||||||
| Control | 32.8% (n=133) | 67.2% (n=273) | 100% (n=406) | |||
| MS | 40.4% (n=219) | 59.6% (n=323) | 100% (n=542) | 0.016 | 100 | |
| Total | 37.1% (n=352) | 62.9% (n=596) | 100% (n=948) | |||
| MS subtypes | ||||||
| Control | 32.8% (n=133) | 67.2% (n=273) | 100% (n=406) | |||
| RRMS | 39.9% (n=147) | 60.1% (n=221) | 100% (n=368) | |||
| SPMS | 42.4% (n=72) | 57.6% (n=98) | 100% (n=170) | 0.030 | 100 | |
| PPMS | 0.0% (n=0) | 100.0% (n=4) | 100% (n=4) | |||
| Total | 37.1% (n=352) | 62.9% (n=596) | 100% (n=948) | |||
Table 4 a-b
Genotype distribution and allele frequency of VDR Taq-I polymorphism in MS patients and healthy controls.
| a) | Taq-I Genotype | |||||
|---|---|---|---|---|---|---|
| C/C | C/T | T/T | Total | p | Power (%) | |
| MS-Control | ||||||
| Control | 16.7% (n=34) | 45.8% (n=93) | 37.5% (n=76) | 100%(n=203) | 0.040 | |
| MS | 26.6% (n=72) | 40.6% (n=110) | 32.8% (n=89) | 100%(n=271) | 99 | |
| Total | 22.4% (n=106) | 42.8% (n=203) | 34.8% (n=165) | 100%(n=474) | ||
| MS subtypes | ||||||
| Control | 16.7% (n=34) | 45.8% (n=93) | 37.5% (n=76) | 100%(n=203) | ||
| RRMS | 23.9% (n=44) | 43.5% (n=80) | 32.6% (n=60) | 100%(n=184) | ||
| SPMS | 32.9% (n=28) | 34.2% (n=29) | 32.9% (n=28) | 100%(n=85) | 0.101 | 100 |
| PPMS | 0.0% (n=0) | 50.0% (n=1) | 50.0% (n=1) | 100%(n=2) | ||
| Total | 22.4% (n=106) | 42.8% (n=203) | 34.8% (n=165) | 100%(n=474) | ||
| b) | Taq-I Allele | |||||
| T | C | Total | p | Power (%) | ||
| MS-Control | ||||||
| Control | 60.3% (n=245) | 39.7% (n=161) | 100% (n=406) | 0.027 | ||
| MS | 53.1% (n=288) | 46.9% (n=254) | 100% (n=542) | 99 | ||
| Total | 56.2% (n=533) | 43.8% (n=415) | 100% (n=948) | |||
| MS subtypes | ||||||
| Control | 60.3% (n=245) | 39.7% (n=161) | 100% (n=406) | |||
| RRMS | 54.3% (n=200) | 45.7% (n=168) | 100% (n=368) | |||
| SPMS | 50.0% (n=85) | 50.0% (n=85) | 100% (n=170) | 0.087 | 100 | |
| PPMS | 75.0% (n=3) | 25.0% (n=1) | 100% (n=4) | |||
| Total | 56.2% (n=533) | 43.8% (n=415) | 100% (n=948) | |||
There were significant differences in Fok-I (Table 3a), Taq-I (Table 4a) polymorphism genotype distributions across MS/MS subtype group and control group. Distribution of the Fok-I polymorphism T/T genotype was 22.5 % (n=61) in the MS group and 13.3% (n=27) in the control group. Otherwise, the distribution of the Fok-I polymorphism C/C genotype was 41.7% (n=113) in the MS group and 47.8 % (n=97) in the control group (Pearson test; p<0.05). The distribution of the Taq-I polymorphism T/T genotype was 26.6 % (n=72) in MS group and 16.7 % (n=34) in the control group. Otherwise, the distribution of the Taq-I polymorphism C/C genotype was 32.8 % (n=89) in the MS group and 37.5 % (n=76) in the control group (Pearson test; p<0.05). Distribution of Fok-I (Table 6a-d) and Taq-I polymorphisms (Table 7a-d) in the MS and control groups differ significantly in dominant, heterozygote, and homozygote inheritance models (Pearson test; p<0.05). However, Fok-I and Taq-I polymorphism genotypes within any binary comparison of MS subtype group and control group were similar (Pearson test; p>0.05). There was no significant difference in Bsm-I (Table 2a, Table 5a-d) polymorphism genotype distribution across MS/MS subtype group and the control group in any inheritance models (Pearson test; p>0.05). Of the 271 MS patients and 203 healthy controls, the VDR gene allele frequencies (allele Fok-I, allele Taq-I and allele Bsm-I) were established.
Table 5a-d
Genotype distribution of VDR Gene Bsm-I polymorphisms in different inheritance models in the MS patients and control group
| a) Bsm-I Recessive Model | ||||
|---|---|---|---|---|
| G/G or G/A | A/A | Total | p | |
| MS-Control | ||||
| Control | 83.3% (n=169) | 16.7% (n=34) | 100% (n=203) | |
| MS | 80.1% (n=217) | 19.9% (n=54) | 100% (n=271) | 0.379 |
| Total | 81.4%(n=386) | 18.6% (n=88) | 100% (n=474) | |
| b) Bsm-I Dominant Model | ||||
| G/G | G/A or A/A | Total | p | |
| MS-Control | ||||
| Control | 36.9% (n=75) | 63.1% (n=128) | 100% (n=203) | |
| MS | 35.8% (n=97) | 64.2% (n=174) | 100% (n=271) | 0.796 |
| Total | 36.3%(n=172) | 63.7% (n=302) | 100% (n=474) | |
| c) | Bsm-I Homozygote Model | |||
| G/G | A/A | Total | p | |
| MS-Control | ||||
| Control | 68.8% (n=75) | 31.2% (n=34) | 100% (n=88) | |
| MS | 64.2% (n=97) | 35.8% (n=54) | 100% (n=172) | 0.442 |
| Total | 33.8%(n=88) | 66.2% (n=172) | 100% (n=260) | |
| d) | Bsm-I Heterozygote Model | |||
| G/G | G/A | Total | p | |
| MS-Control | ||||
| Control | 44.4% (n=75) | 55.6% (n=94) | 100% (n=169) | |
| MS | 44.7% (n=97) | 55.3% (n=120) | 100% (n=217) | 0.950 |
| Total | 55.4%(n=214) | 44.6% (n=172) | 100% (n=386) | |
The proportions of the alleles of Bsm-I, Fok-I, and Taq-I polymorphisms are shown in Table 2b, Table 3b and Table 4b, respectively. Chi-square tests were performed for frequency of the VDR gene alleles within MS/MS subtype group and the control group (Table 2b, Table 3b, Table 4b). There were significant differences of Fok-I (Table 3b) and Taq-I (Table 4b) polymorphism allele frequencies across MS/MS subtype group and the control group. The frequency of the Fok-I T allele was 40.4 % (n=219) in the MS group and 32.8 % (n=133) in the control group (MS/control odds ratio=1.391; CI 95%=1.063-1.821). Otherwise, the frequency of the Fok-I C allele was 59.6% (n=323) in the MS group and 67.2 % (n=273) in the control group (MS/ control odds ratio=0.719; CI 95%=0.549-0.940) (Pearson test; p<0.05). The frequency of the Fok-I T allele was 42.4 % (n=72) in the SPMS subtype group and 39.9 % (n=147) in the RRMS subtype group. Otherwise, the frequency of the Fok-I C allele was 57.6% (n=98) in the SPMS subtype group; 60.1% (n=221) in the RRMS subtype group and 100% (n=4) in the PPMS subtype group (Pearson test; p<0.05). The frequency of Taq-I C allele was 46.9% (n=254) in the MS group and 39.7% (n=161) in the control group (MS/control odds ratio=1.342; CI 95%= 1.034-1.742). Otherwise, the frequency of the Taq-I T allele was 53.1% (n=288) in the MS group and 60.3 % (n=245) in the control group (MS/control odds ratio=0.745; %95 CI= 0.574-0.967) (Pearson test; p<0.05). However, the frequency of the Taq-I allele within any binary comparison of the MS subtypes group and the control group were similar (Pearson test; p>0.05). There was no significant difference in the Bsm-I (table 2b) polymorphism allele frequencies across the MS/MS subtype group and control group.
Table 6a-d
Genotype distribution of VDR Gene Fok-I polymorphisms in different inheritance models in the MS patients and control group
| a) | Fok-I Recessive Model | |||
|---|---|---|---|---|
| T/C or TT | C/C | Total | p | |
| MS-Control | ||||
| Control | 52.2% (n=106) | 47.8% (n=97) | 100% (n=203) | |
| MS | 58.3% (n=158) | 41.7% (n=113) | 100% (n=271) | 0.187 |
| Total | 55.7%(n=264) | 44.3% (n=210) | 100% (n=474) | |
| b) | Fok-I Dominant Model | |||
| T/T | T/C or C/C | Total | p | |
| MS-Control | ||||
| Control | 13.3% (n=27) | 86.7% (n=176) | 100% (n=203) | |
| MS | 22.5% (n=61) | 77.5% (n=210) | 100% (n=271) | 0.011 |
| Total | 18.6%(n=88) | 81.4% (n=386) | 100% (n=474) | |
| c) | Fok-I Homozygote Model | |||
| T/T | C/C | Total | p | |
| MS-Control | ||||
| Control | 21.8% (n=27) | 78.2% (n=97) | 100% (n=124) | |
| MS | 35.1% (n=61) | 64.9% (n=113) | 100% (n=174) | 0.013 |
| Total | 29.5%(n=88) | 70.5% (n=210) | 100% (n=298) | |
| d) | Fok-I Heterozygote Model | |||
| T/T | T/C | Total | p | |
| MS-Control | ||||
| Control | 25.5% (n=27) | 74.5% (n=79) | 100% (n=106) | |
| MS | 38.6% (n=61) | 61.4% (n=97) | 100% (n=158) | 0.026 |
| Total | 33.8%(n=88) | 66.7% (n=176) | 100% (n=264) | |
Table 7a-d
Genotype distribution of VDR Gene Taq-I polymorphisms in different inheritance models in the MS patients and control group
| a) | Taq-I Recessive Model | |||
|---|---|---|---|---|
| T/C or T/T | C/C | Total | p | |
| MS-Control | ||||
| Control | 62.6% (n=127) | 37.4% (n=76) | 100% (n=203) | |
| MS | 67.2% (n=182) | 32.8% (n=89) | 100% (n=271) | 0.299 |
| Total | 65.2%(n=309) | 34.8% (n=165) | 100% (n=474) | |
| b) | Taq-I Dominant Model | |||
| T/T | T/C or C/C | Total | p | |
| MS-Control | ||||
| Control | 16.7% (n=34) | 83.3% (n=169) | 100% (n=203) | |
| MS | 26.6% (n=72) | 73.4% (n=199) | 100% (n=271) | 0.011 |
| Total | 22.4%(n=106) | 77.6% (n=368) | 100% (n=474) | |
| c) | Taq-I Homozygote Model | |||
| T/T | C/C | Total | p | |
| MS-Control | ||||
| Control | 30.9% (n=34) | 69.1% (n=76) | 100% (n=110) | |
| MS | 44.7% (n=72) | 55.3% (n=89) | 100% (n=161) | 0.022 |
| Total | 39.1%(n=106) | 60.9% (n=165) | 100% (n=271) | |
| d) | Taq-I Heterozygote Model | |||
| T/T | T/C | Total | p | |
| MS-Control | ||||
| Control | 26.8% (n=34) | 73.2% (n=93) | 100% (n=127) | |
| MS | 39.6% (n=72) | 60.4% (n=110) | 100% (n=182) | 0.020 |
| Total | 34.3%(n=106) | 65.7% (n=203) | 100% (n=309) | |
Among the MS patients, there were 188 males and 83 females. Distribution of the VDR gene genotypes and allele frequencies did not differ across genders in the MS patients (Table 8a-c and Table 9a-c). However, only the frequency of the Bsm-I alleles (G and A) were distributed significantly between males and females (Table 9a). The frequency of the Bsm-I G allele was 61.7% among females and the frequency of Bsm-I A allele was 52% among males (Pearson test; p<0.05).
Table 8a-c
Distribution of VDR gene Polymorphisms within gender in MS patients
| a) | Bsm-I Genotype | ||||
|---|---|---|---|---|---|
| G/G | G/A | A/A | Total | p | |
| Gender | |||||
| Female | 37.2% (n=70) | 43.6% (n=82) | 19.1% (n=36) | 100% (n=188) | |
| Male | 32.5% (n=27) | 45.8% (n=38) | 21.7% (n=18) | 100% (n=83) | 0.740 |
| Total | 35.8% (n=97) | 44.3% (n=120) | 19.9% (n=54) | 100% (n=271) | |
| b) | Fok-I Genotype | ||||
| T/T | T/C | C/C | Total | p | |
| Gender | |||||
| Female | 22.3% (n=42) | 33.0% (n=62) | 44.7% (n=84) | 100% (n=188) | |
| Male | 22.9% (n=19) | 42.2% (n=35) | 34.9% (n=29) | 100% (n=83) | 0.262 |
| Total | 22.5% (n=61) | 35.8% (n=97) | 41.7% (n=113) | 100% (n=271) | |
| c) | Taq-I Genotype | ||||
| C/C | C/T | T/T | Total | p | |
| Gender | |||||
| Female | 34.6% (n=65) | 41.0% (n=77) | 24.5% (n=46) | 100% (n=188) | |
| Male | 28.9% (n=24) | 39.8% (n=33) | 31.3% (n=26) | 100% (n=83) | 0.449 |
| Total | 32.8% (n=89) | 40.6% (n=110) | 26.6% (n=72) | 100% (n=271) | |
Table 9a-c
Distribution of VDR gene allele within gender in MS patients
| a) | Bsm-I Allele | |||
|---|---|---|---|---|
| G | A | Total | p | |
| Gender | ||||
| Female | 61.7% (n=153) | 38.3% (n=95) | 100% (n=248) | |
| Male | 48.0% (n=49) | 52.0% (n=53) | 100% (n=102) | 0.019 |
| Total | 57.7%(n=202) | 42.3% (n=148) | 100% (n=350) | |
| b) | Fok-I Allele | |||
| T | C | Total | p | |
| Gender | ||||
| Female | 29.0% (n=72) | 71.0% (n=176) | 100% (n=248) | 0.800 |
| Male | 30.4% (n=31) | 71.0% (n=69.6) | 100% (n=102) | |
| Total | 55.7%(n=264) | 70.6% (n=247) | 100% (n=350) | |
| c) | Taq-I Allele | |||
| T | C | Total | p | |
| Gender | ||||
| Female | 37.5% (n=93) | 37.4% (n=76) | 100% (n=248) | 0.137 |
| Male | 46.1% (n=47) | 53.9% (n=55) | 100% (n=102) | |
| Total | 40.0%(n=140) | 60.0% (n=210) | 100% (n=350) |
Discussion
MS is an immune mediated chronic inflammatory demyelinating disease of CNS. While very little is known about the etiology of this disease, vitamin D as well as its receptor gene, VDR, are thought to be associated with MS. However, this is a controversial topic since there is disagreement in the literature. Therefore, we have evaluated the polymorphisms in the vitamin D receptor (VDR) among 271 MS patients and 203 healthy controls to determine if we observed any association with it and MS in the Turkish population. Our results showed a significant relationship in the Turkish population between VDR gene polymorphisms among MS or MS subtypes. This was true for two distinct (Fok-I and Taq-I) VDR gene polymorphisms. However, there was no significant relationship between VDR gene Bsm-I polymorphism with MS or MS subtypes in our study.
Previous research evaluating the effect of exogenous vitamin D in prevention of MS development based on genetic tendency has helped to establish the importance of polymorphisms [22]. The Fok-I polymorphism is a T/ C allele variation located in exon 2 which is in the translation initiation site of VDR. An interaction was observed between the dietary intake of vitamin D and the VDR Fok-I polymorphism and risk of MS. It was argued that vitamin D has a higher effect on MS prevention in women carrying the T allele [22]. Therefore, the determination of immune status by genetic predisposition, according to vitamin D intake, allowed for better assessment of MS risk [22]. However, there was no association between Fok-I polymorphisms on the VDR gene and MS in the Australian population [25]. In a separate study evaluating MS patients in the British population, there is a tendency for low VDR expression in people with the Fok-I polymorphism (T/T) genotype on the VDR gene. However, the relationship between MS and VDR single nucleotide polymorphisms has not been established, as results in the studies differ from each other [29]. Smolders et al. observed a relation between the Fok-I polymorphism in the VDR gene and the level of vitamin D. The C allele of the Fok-I polymorphism is associated with decreased 25(OH)D and increased 1,25-dihydroxyvitamin D (1,25(OH)D) levels [29]. Polymorphisms in the VDR gene were found to be associated with the severity and course of MS, as Mamutse et al. demonstrate that the Fok-I allele was associated with a decreased 10 year disability level, following initial disease development [30]. By contrast, a meta-analysis [22, 23, 25, 29, 31, 32] conducted on the Caucasian population indicates that the risk of MS is independent of Fok-I polymorphisms in dominant, heterozygote and recessive gene models [7]. Another study found that distribution of the VDR gene Fok-I polymorphisms was associated with MS in the Turkish population [33]. In a meta-analysis covering the research up to 2019, there was no association found between Fok-I polymorphisms and MS [34]. In our study, it was found that the Fok-I T/T polymorphism on the VDR gene in a dominant inheritance model and Fok-I T allele frequency were significantly associated with MS in Turkish population.
The Bsm-I polymorphism is located in intron 8 of VDR and has a G/A variation. The first studies to report a relationship between MS and Bsm-I polymorphisms on the VDR gene were found in the Japanese population [14, 24]. However, it was later found that there was no association between Bsm-I polymorphisms on the VDR gene and MS in the Canadian population [35]. In the meta-analysis of studies up to 2019, there was no association between Bsm-I polymorphisms and MS, but when compared with the European population and the Asian population, there was an association between Bsm-I polymorphisms and MS [34]. In our study, it was found that there was no association between Bsm-I polymorphisms on the VDR gene and MS in the Turkish population.
The Taq-I polymorphism is found at exon 9 of VDR with a C/T variation. An association was found between the Taq-I polymorphisms on the VDR gene and MS in the Australian population [25]. In contrast to this study, there was no association between the Taq-I polymorphisms and MS in the Canadian population [35]. A similar study found that there was no association between Taq-I polymorphisms on the VDR gene and MS in the Turkish population [33]. The aforementioned meta-analysis includes the research on this subject until 2019, and there was an association between Taq-I polymorphisms and MS only in the heterozygote model, but not in other inheritance models [34]. The results of our study showed that Taq-I C/ C polymorphism on the VDR gene in dominant, homozygote and heterozygote inheritance models, and C allele frequency were significantly associated with MS in the Turkish population. In summary, we found that a significant relationship in the Turkish population exists between VDR gene polymorphisms (Fok-I, and Taq-I) and MS. A similar study among the Turkish population found an association between VDR gene Fok-I polymorphisms and MS. According to this study, however, there was no association between Taq-I VDR gene polymorphisms and MS. These data are important, since previous reports on this topic differ from one another, and more studies are needed. Some of the limitations of our study which should be considered include: small sample size and a different ethnicity, compared to other studies. These limitations might be the reason for the contradictions between our study and the study of Kamisli et al. among the Turkish population. Accordingly, our study adds further evidence to the argument that VDR is associated with MS, at least in certain populations.
Acknowledgements
This work was supported by the grant from The Marmara University Research Foundation.
Notes
[1] Declaration of Interest
The authors report no conflicts of interest. The authors alone are responsible for the content and writing of this article.
[2] Author Contributions
BB: conducted the experiments and analyzed the data; HAY: conducted the experiments and developed the methodology; KSN: developed the methodology and provisioned the materials;
CA: developed the methodology and provisioned the materials; CEA: provisioned the materials; IN: provisioned the materials; ELO: prepared the published work; AA: planned, executed the research and prepared the published work.