Evaluation of the Genetic Structure of Polish Red-and-White Cattle to Support Their Genetic Resources Conservation Program Cover

.blurhash-client-img { display: none !important; }

Evaluation of the Genetic Structure of Polish Red-and-White Cattle to Support Their Genetic Resources Conservation Program

Annals of Animal Science

Volume 26 (2026): Issue 1 (January 2026)

By: Anna Radko, Ewa Sosin, Anna Koseniuk and Agnieszka Szumiec

Open Access

|Jan 2026

Figures & Tables

STRUCTURE analysis of 12 STR genotypes from cattle studied. The samples were grouped by the 3 breeds (K=3): PRW – Polish Red-and-White; HO – Polish Holstein Black-and-White variety; RW – Polish Holstein Red-and-White variety. The average proportion of assignments to the cluster (Q) above 94% was found for the PRW breed, and above 95% and 91% for RW and HO, respectively

Principal Coordinates Analysis (PCoA). PCoA analysis based on genetic distances showed 3 clustered populations corresponding to the cattle breeds studied. PRW – Polish Red-and-White; HO – Polish Holstein Black-and-White variety; RW – Polish Holstein Red-and-White variety

Determination of the % of the Polish Red-and-White breed for three PRW individuals included in the genetic resources conservation program

Microsatellite markers of the main set (12-plex) for verification of pedigrees and primers for their amplification

Locus	Starter sequences (5'-3')
BM1818	agctgggaatataaccaaagg, agtgctttcaaggtccatgc
BM1824	gagcaaggtgtttttccaatc, cattctccaactgcttccttg
BM2113	gctgccttctaccaaataccc, cttcctgagagaagcaacacc
INRA023	gagtagagctacaagataaacttc, taactacagggtgttagatgaactc
ETH3	gaacctgcctctcctgcattgg, actctgcctgtggccaagtagg
ETH10	gttcaggactggccctgctaaca, cctccagcccactttctcttctc
ETH225	gatcaccttgccactatttcct, acatgacagccagctgctact
SPS115	aaagtgacacaacagcttctccag, aacgagtgtcctagtttggctgtg
TGLA53	gctttcagaaatagtttgcattca, atcttcacatgatattacagcaga
TGLA122	ccctcctccaggtaaatcagc, aatcacatggcaaataagtacata
TGLA126	ctaatttagaatgagagaggcttct, ttggtctctattctctgaatatcc
TGLA227	cgaattccaaatctgttaatttgct, acagacagaaactcaatgaaagca

Polymorphism indices of the 12 STR markers analyzed in PRW cattle

STR	H_O	H_E	F_is	PIC	PD	PE₁	PE₂
BM1818	0.6250	0.5640	−0.1082	0.4769	0.7017	0.1624	0.2803
BM1824	0.7083	0.6834	−0.0365	0.6178	0.8263	0.2468	0.4038
BM2113	0.8889	0.8281	−0.0735	0.8044	0.9388	0.4788	0.6528
ETH3	0.7431	0.7204	−0.0315	0.6864	0.8843	0.3223	0.5057
ETH10	0.5139	0.5684	0.0959	0.5151	0.7578	0.1695	0.3230
ETH225	0.7500	0.7481	−0.0025	0.7053	0.8927	0.3420	0.5173
INRA23	0.8333	0.8024	−0.0386	0.7742	0.9282	0.4349	0.6118
SPS115	0.5625	0.5515	−0.0200	0.5112	0.7345	0.1668	0.3298
TGLA53	0.8542	0.8580	0.0044	0.8420	0.9596	0.5541	0.7154
TGLA122	0.8403	0.7989	−0.0518	0.7746	0.9323	0.4479	0.6229
TGLA126	0.6806	0.6859	0.0078	0.6250	0.8382	0.2550	0.4162
TGLA227	0.8264	0.8200	−0.0078	0.7956	0.9414	0.4682	0.6426
Means	0.736	0.72	−0.022	0.677
Cumulative value					1	0.994407	0.99986

Assessment of the Hardy-Weinberg equilibrium (HWE)

STR	P	χ²
BM1818	0.9015	4.8412
BM1824	0.9199	4.5361
BM2113	0.6321	24.9210
ETH3	0.7852	21.9160
ETH10	0.9562	7.0514
ETH225	0.6810	17.4897
INRA23	0.8853	19.3997
SPS115	0.0014^*	28.5992
TGLA53	0.9428	39.5093
TGLA122	0.9103	51.1787
TGLA126	0.6592	12.2608
TGLA227	0.9057	25.4194

DOI: https://doi.org/10.2478/aoas-2025-0075 | Journal eISSN: 2300-8733 | Journal ISSN: 1642-3402

Journal RSS Feed

Language: English

Page range: 307 - 313

Submitted on: Feb 10, 2025

|

Accepted on: Jun 18, 2025

|

Published on: Jan 30, 2026

Published by: National Research Institute of Animal Production

In partnership with: Paradigm Publishing Services

Publication frequency: Volume open

Keywords:

Bayesian clustering

Related subjects:

Veterinary medicine

© 2026 Anna Radko, Ewa Sosin, Anna Koseniuk, Agnieszka Szumiec, published by National Research Institute of Animal Production
This work is licensed under the Creative Commons Attribution 3.0 License.

Previous article Volume 26 (2026): Issue 1 (January 2026)Next article