Skip to main content
Have a personal or library account? Click to login
Potential Gastric Cancer Immunotherapy: Stimulating the Immune System with Helicobacter pylori pIRES2-DsRed-Express-ureF DNA Vaccines Cover

Potential Gastric Cancer Immunotherapy: Stimulating the Immune System with Helicobacter pylori pIRES2-DsRed-Express-ureF DNA Vaccines

Open Access
|Feb 2024

Figures & Tables

Fig 1.

(A) Single colonies of transformed bacteria containing plasmid with uref gene; Non-growth of vector-free cells in agar medium containing the antibiotic kanamycin (negative control); Preparation of matrix from a number of selected colonies. (B) Validation of 805 base pairs of ureF gene in H. pylori genome by PCR test, 1: DNA markerIII, 2: 805 base pairs of ureF gene, 3: Negative control; (C) the successful production of the recombinant plasmid. 1: DNA markerIII, 2: recombinant pIRES2-DsRed-Express-ureF before digestion, 3: recombinant pIRES2-DsRed-Express-ureF after digestion; (D) Expression of recombinant pIRES2-DsRed-Express-ureF in protein level. 1: Protein marker, 2: Negative control; 3 and 4: pIRES2-DsRed-Express-ureF.

Fig 2.

An analysis of the immunological responses and suppressive effects of splenic T-cells induced by H. pylori DNA immunizations. (A) ELISA measured serum IgG1 and IgG2a concentrations in several groups of vaccinated mice. (B) ELISA measurements of TNF-α, IFN-γ, IL-4, and IL-17 relative levels and concentrations in different mouse immunization groups. *P<0.05, **P<0.01, ***P<0.001 and ns: not significant.

Fig 3.

Cytokine levels were found in the small intestine (A) and spleen (B) of the control and immunized groups. (C) Peripheral CD3+, CD4+, and CD8+ T-cell subpopulations in vaccinated mice were analyzed by flow cytometry. The immunization against pIRES2-DsRed-Express-ureF suppresses the invasion and growth of cancerous cells in the culture. (D) The MTT test examined the growth indices of three groups of AGS and MKN28 cells. Compared to the control group, the growth rate in the pIRES2-DsRed-Express-ureF group was considerably reduced. (E) Cell cycle regulation in cells was investigated using flow cytometry. Compared to the control group, the pIRES2-DsRed-Express-ureF vaccination group showed an increase in G0/G1 reduction in the proportion of the S phase to the G2/M phase. (F) The proportion of apoptotic cells was higher in the pIRES2-DsRed-Express-ureF vaccination group. *P<0.05, **P<0.01, and ns: not significant.

Fig 4.

The immunization against pIRES2-DsRed-Express-ureF suppresses the invasion and growth of cancerous cells in the culture. (A) According to a flow cytometry experiment, pIRES2-DsRed-Express-ureF caused 54.82 and 57.18% of AGS and MKN28 cells to undergo apoptosis, respectively. (B,C) The colony formation assay using pIRES2-DsRed-Express-ureF transfected AGS and MKN28 cells revealed that they proliferated. (D,E) The quantity of invading AGS and MKN28 cells. *P<0.05, **P<0.01, ***P<0.001 and ns, not significant.

Fig 5.

Splenic T-cells stimulated by H. pylori vaccinations have anticancer effects in vivo and in vitro. (A) The inhibition percentages of H. pylori-activated splenic T-cells on in vitro-cultured AGS and MKN28 cell lines. (B) Splenic T-cells stimulated by H. pylori vaccinations have anticancer effects in vivo. Mouse body weight variation curves from day 0 to day 15 after adoptive infusions. (C) Tumor nodule size curves in animals from 0 to 15 days following T-cell infusions. (D) The mean weights of the mouse tumor nodules that were excised. (E) The levels of tumor inhibition in the various experimental groups. *P<0.05, **P<0.01, and ns: not significant.

Fig 6.

Evaluation of the xenograft tumor’s infiltrating immune cell subpopulations following adoptive T-cell infusions. (A) Illustration of CD4+ and CD8+ T cell invasion using representative staining, 20X magnification. (B) Positive T cell infiltration index and CD8+/CD4+ ratios in different groups. (C) Representative stains showing infiltrating CD68+ macrophages and FOXP3+ T cells, 20x magnification. (D) The FOXP3+ T cell and penetrated CD68+ macrophage infiltration positivity index. (E) Representative staining of the CD56+ NK lymphocytes and CD86+ M1 macrophages invaded, 20x magnification. (F) Positive infiltration index for CD56+ NK cells and CD86+ M1 macrophages. *P<0.05, **P<0.01, and ns: not significant.

Fig 7.

(A) Illustration of CD4+ and CD8+ T cell invasion using representative staining, 20X magnification. (B) Caspase-9, Caspase-8, Cleaved Caspase-3, and Survivin signals in the xenograft tumor following adoptive T-cell infusions were examined by Western blot analysis. L1: Procaspase-9 (51 kDa); L2: Cleaved Caspase-9 (37 kDa); L3: Caspase-8 (57 kDa); L4: Cleaved Caspase-3 (17 kDa); L5: Survivin (16 kDa); L6: Negative control; M: Protein ladder. (C) L1-L6: GAPDH (20 kDa). *P<0.05, **P<0.01, and ns, not significant.

Fig 8.

Caspase-9, Caspase-8, Cleaved Caspase-3, and Survivin signals in the xenograft tumor following adoptive T-cell infusions were examined by Western blot analysis. 1: Procaspase-9 (51 kDa); 2: Cleaved Caspase-9 (37 kDa); 3: Caspase-8 (57 kDa); 4: Cleaved Caspase-3 (17 kDa); 5: Survivin (16 kDa); 6: Negative control; M: Protein ladder. GAPDH (20 kDa).

Fig S1.

Schematic illustration of pIRES2-DsRed-Express plasmid.

Fig S2.

DNA sequence of ureF target gene inserted into pIRES2-DsRed-Express vector.

Fig S3.

Single colonies of transformed bacteria containing plasmid with ureF gene; Non-growth of vector-free cells in agar medium containing the antibiotic kanamycin (negative control); Preparation of matrix from a number of selected colonies.

Sequence of specific primers for real-time PCR reaction

GeneSizePrimer sequence
IFN-γ188 bp
  • F: 5′- GCCTAGCTCTGAGACAATGAACG -3′

  • R: 5′- GCCAGTTCCTCCAGATATCCAAG -3′

IL4263 bp
  • F: 5′- TCACAGGAGAAGGGACGCCATG -3′

  • R: 5′- TGGACTTGGACTCATTCATGGTGC -3′

IL17246 bp
  • F: 5′- CTACAGTGAAGGCAGCAGCGATC -3′

  • R: 5′- CTTTCCCTCCGCATTGACACAG -3′

GAPDH250 bp
  • F: 5′- ACCTTGGAAATAAATGGGAAG -3′

  • R: 5′- CTTCTGTGTTGCTGTAGTTGC -3′

ureF802 bp
  • F: 5′- GTTGATAAAAGTTCCTGGCT -3′

  • R: 5′- ACATGCATCGAAATATGATGTGCA -3′

The number of mice used in this experiment

Group numberInjection compositionNumber of miceAverage weight of miceType of injectionTime of injection (Day)
1pIRES2-DsRed-Express-ureF2019.7 ± 0.5IM0, 15, 30
2pIRES2-DsRed-Express2018.2 ± 0.7IM0, 15, 30
3PBS2019.4 ± 0.68IM0, 15, 30
Language: English
Submitted on: Feb 26, 2023
Accepted on: Sep 20, 2023
Published on: Feb 12, 2024
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year

© 2024 Mahsa Afkhamipour, Fatemeh Kaviani, Samaneh Dalali, Tohid Piri-Gharaghie, Abbas Doosti, published by Hirszfeld Institute of Immunology and Experimental Therapy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.