1,4-dihydropyridine derivatives increase mRNA expression of Psma3, Psmb5, and Psmc6 in rats

This study was approved by the Animal Ethics Committee of the Food and Veterinary Service (Riga, Latvia) and was carried out according to the guidelines of the 1986 European Convention for the Protection of Vertebrate Animals Used for Experimental and other Scientific Purposes (16). Male Wistar rats (215.0±5.6 g) were purchased from the Laboratory of Experimental Animals, Riga Stradins University, Riga, Latvia. Animals were kept at 22±0.5 °C with a 12 h light/dark cycle and fed standard laboratory diet.

All drugs used in the study – metcarbatone, etcarbatone, glutapyrone, styrylcarbatone (J-9-125), and AV-153 Na and Ca salts (Figure 1) were synthesised at the Latvian Institute of Organic Synthesis. Other chemicals were purchased from Sigma-Aldrich Chemie (Taufkirchen, Germany).

Figure 1

Formulas of 1,4-dihydropyridine derivatives used in the study

Rats were divided into control and treatment groups. The latter received 0.05 mg/kg or 0.5 mg/kg of metcarbatone, etcarbatone, glutapyrone, styrylcarbatone, AV-153-Na, or AV-153-Ca per os by gavage for three days. The rats were then euthanised and their organ samples (kidneys, blood, and liver) taken and frozen in liquid nitrogen until analysis. There were two sets of rats. Kidneys and blood were taken from the control group (11 animals) and groups treated with metcarbatone, etcarbatone, glutapyrone, and styrylcarbatone (3–4 animals per group). Kidneys and liver were taken from the control group (10 animals) and groups treated with AV-153-Na and AV-153-Ca (3–5 animals per group).

Total RNA was isolated from the kidneys, blood, and liver with a TRI reagent (Sigma Aldrich, Taufkirchen, Germany). RNA was purified from DNA with a DNA-free kit (Ambion, Austin, TX, USA) and its quantity and purity determined with a NanoPhotometer ^® NP 80 spectrophotometer (ImplenGMBH, Munich, Germany).

The quality of RNA was analysed with gel electrophoresis. cDNA was synthesised from the obtained RNA (5 μg from kidneys and liver, and 2 μg from blood) with random hexamer primers (RevertAid^™ First Strand cDNA Synthesis Kit, Fermentas, Vilnius, Lithuania).

mRNA expression of Psma3, Psmb5 and Psmc6, and a reference gene (RNA-polymerase II) in the kidney, blood, and liver was determined using the SYBR^® Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) according to the instructions provided by the manufacturer. For the AV-153-Na and AV-153-Ca treatment groups, we also determined the expression of the Psma6 gene.

Primers were designed using Primer‑BLAST software ( 1 7 ) . Primer sequences were: Psma3 – 5’‑CACCATCCTCTGGTGTCCATT‑3’ (forward) and 5’‑CGCAGATATCCTCAATTACCCAAC‑3’ (reverse) ( fragment size 1 2 8 b p ) ; P s m b 5 – 5’‑AGGTGCCTACATTGCTTCCC‑3’ (forward) and 5’‑GAGATGCGTTCCTTGTTGCG‑3’ (reverse) (fragment size 159 bp); Psmc6 – 5’‑TACATTGGGGAAAGCGCTCG‑3’ (forward) and 5’‑TCAGAAAACCGACGACCACC‑3’ (reverse) (fragment size 116 bp); and Psma6 – 5’‑GTGTGCGCTACGGGGTGTA‑3’ (forward) and 5’‑AGTCACGGTGCTGGAATCCA‑3’ (reverse) (fragment size 247 bp). The choice of the reference RNA‑polymerase II gene was described earlier (18). Primer sequences for this gene were 5’‑GCCAGAGTCTCCCATGTGTT‑3’ (forward) and 5’‑GTCGGTGGGACTCTGTTTGT‑3’ (reverse) (amplified fragment size 135 bp).

Oligonucleotides were supplied by Metabion International AG (Martinsried, Germany). qPCR reactions were performed using a StepOne™ Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Cycling conditions were as follows: one cycle at 95 ºC for 10 min, 40 cycles at 95 ºC for 15 sec, and one cycle at 60 ºC for 1 min (Applied Biosystems StepOne software, version 2.1). The specificity of amplification products was verified by dissociation curve: one cycle at 95 ºC for 15 sec, one at 60 ºC for 1 min, and one at 95 ºC for 15 sec. The cycle threshold (C_t) values are presented in Tables 1 and 2.

Reference gene stability was analysed with BestKeeper provided in RefFinder (https://www.heartcure.com). Among studied organs, standard deviation (SD) values ranged from 0.22 to 0.54, and the coefficient of variance (CV) ranged from 1.13 to 2.63. These values are consistent with those reported for stable housekeeping genes (19). Gene expression data were expressed using the 2^-ΔΔCt method – mean fold difference with standard error of the mean (SEM) (20). The P values were calculated from delta values using one-way ANOVA followed by Dunnett’s test for multiple comparisons between the groups. In all tests, the P value of <0.05 was considered statistically significant. All analyses were run on the GraphPad Prism 6 version 6.01 software (GraphPad Software, San Diego, CA, USA).

In the kidney, metcarbatone at both doses significantly increased the expression of the Psma3, Psmb5, and Psmc6 genes (Table 3). The higher dose produced a more pronounced effect for Psma3 and Psmb5. The increase ranged from 1.43-fold with Psmc6 (0.05 mg/kg: P=0.010; 0.5 mg/kg: P=0.015) to 1.69-fold with Psmb5 (0.5 mg/kg: P=0.001). In the blood, metcarbatone significantly decreased the Psmc6 gene expression by 0.60 (0.5 mg/kg: P=0.032).

The Psma3, Psmb5, and Psmc6 gene expression significantly increased in the kidney (Table 4), from 1.36-fold at the higher dose for Psma3 (P=0.046) to 1.82-fold at the lower dose for Psmb5 (P=0.002). No significant differences were detected in the blood.

Styrylcarbatone significantly increased the expression of the Psma3, Psmb5 and Psmc6 genes (Table 5). It was the most pronounced for Psmc6 – up to 2.05-fold at the lower dose (P<0.0001). No significant differences were detected in the blood.

In the kidney, the higher dose of glutapyrone significantly increased Psmb5 expression 1.73-fold (P=0.003; Table 6) and Psmc6 expression up to 1.59-fold (P=0.004). In the blood, the lower dose of glutapyrone increased Psmb5 expression 2.04-fold (P=0.036).

AV-153-Na significantly increased the expression of Psma3, Psmb5, Psmc6, and Psma6 at both doses (Table 7) in the kidney. The higher dose resulted in the highest (2.17-fold) increase in Psma6 (P=0.0007), while the lower dose increased it 1.91-fold (P=0.0002). Psmc6 gene expression increased 1.61-fold at the higher dose (P=0.017), but the lower dose decreased the Psmb5 gene expression by 0.79 (P=0.029).

In the kidney, AV-153-Ca significantly affected only the Psmb5 gene expression, which decreased by 0.62 at the lower dose (P=0.0043; Table 8). In the blood, Psma6 gene expression increased 1.35-fold at the lower dose. Other tested genes were not affected significantly.