Have a personal or library account? Click to login
Molecular mechanisms of colistin resistance mediated by pmrCAB genes in Acinetobacter baumannii isolated from patients hospitalized in Isfahan medical centers Cover

Molecular mechanisms of colistin resistance mediated by pmrCAB genes in Acinetobacter baumannii isolated from patients hospitalized in Isfahan medical centers

Open Access
|Apr 2024

Figures & Tables

Figure 1.

The results of antimicrobial susceptibility of A. baumannii to the antibiotics investigated in this study. Overall, piperacillin/tazobactam, meropenem, and ciprofloxacin were the most commonly resistant antibiotics (100%). The two most effective antibiotics were colistin (84.5%) and amikacin (9.25%). SAM: Ampicillin-sulbactam; TZP: piperacillin/tozabactam; CAZ: Ceftazidime; FEP: cefepime; MEM: Meropenem; GM: Gentamicin; AN: amikacin; CIP: ciprofloxacin; SXT: Trimethoprim-sulfamethoxazole; and CL: Colistin

Figure 2

PCR amplification of the PmrA, B and C genes. Ladder: 100 bp-2kb ladder, lane 1: positive control for PmrA (120bp), B (150bp) and C (132bp) genes; lane 2–9: positive results and negative control

Oligonucleotide sequences used in this study

PrimerPrimer sequence (5ʹ to 3ʹ)Amplicon sizeAnnealing temperature
PmrA(F)GATGGTTTAAATTTGGGTGCAGAT12058
PmrA(R)TTGACTCGCAAGTTGAGCTTCT
PmrB(F)GCCATTATTCGTCGTGGTTTAAA15057
PmrB(R)GCGCTCAAAAAGACGGTTCA
PmrC(F)CCATTTGGCTAGGTGCAATTT13257
PmrC(R)CCGCATAATAGGTAGCAACAAG
Language: English
Page range: 52 - 57
Submitted on: Jun 2, 2023
|
Accepted on: Jan 10, 2024
|
Published on: Apr 28, 2024
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year

© 2024 Ali Abbasi, Bahareh Hajihashemi, Dariush Shokri, published by Hirszfeld Institute of Immunology and Experimental Therapy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.