Skip to main content
Have a personal or library account? Click to login
Molecular mechanisms of colistin resistance mediated by pmrCAB genes in Acinetobacter baumannii isolated from patients hospitalized in Isfahan medical centers Cover

Molecular mechanisms of colistin resistance mediated by pmrCAB genes in Acinetobacter baumannii isolated from patients hospitalized in Isfahan medical centers

Open Access
|Apr 2024

Full Article

1. Introduction

The spread of Acinetobacter baumannii (A. baumannii) infections that are resistant to multiple drugs is a growing concern [1]. Antibiotics, such as beta-lactams, aminoglycosides, fluoroquinolones and carbapenems, which are important groups of antibiotics, are becoming increasingly ineffective against A. baumannii, leaving no effective treatment options available [2,3]. This issue poses a serious challenge for clinicians treating MDR A. baumannii infections [4].

The emergence of bacterial strains exhibiting resistance to a wide range of antibiotics commonly available in the commercial market and the shortage of novel antibiotics effective MDR Gram-negative bacteria has led to the use of colistin (polymyxin E) as a valuable therapeutic option [5]. However, there have been an increasing number of reports of colistin-resistance among the A. baumannii stain [6].

The resistance of Gram-negative bacteria to colistin is attributed to a range of different mechanisms. Among these, the most prevalent one in A. baumannii is the alteration of the lipid A factor of the lipopolysaccharide layer in the outer membrane, that is primarily facilitated through the pmrCAB operon [7].

The pmrAB two-component system regulates the expression of the pmrC gene, which is accountable for the addition of phosphoethanolamine (pEtN) to lipid A. Consequently, this leads to a reduction in the negative charge on the outer membrane, thereby affecting the binding of colistin and preventing harm to the stability and structure of the cell membrane [8,9]. According to reports, mutations in pmrAB result in an increase in pmrC expression, which is associated with higher colistin minimum inhibitory concentrations (MICs) [10].

A. baumannii has the potential to rapidly acquire colistin resistance (CoR) through several mechanisms that are challenging to screen with straightforward molecular diagnostic tests. This scenario has significant implications for effectively treating this rapidly emerging pathogen in the future [7]. In addition, CoR in Gram-negative bacteria has been described sporadically, and new agents effective against such organisms are not available.

Due to the limited number of studies conducted in Iran, especially within the region, investigating the mechanisms of resistance to colistin, the purpose of this research was to determine the frequency of XDR, resistance to colistin, and the characterization and mutations in pmrCAB genes among A. baumannii isolated from inpatients.

2. Materials and methods

2.1. Patients, sample collection and identification

A total of 108 nonduplicated clinical isolates of A. baumannii have been obtained from different teaching hospitals in Isfahan, Iran, during 2021 to 2022. Different clinical samples, such as urine, wound, blood and respiratory secretions, were collected to obtain the clinical isolates. Furthermore, the specimens were promptly transferred in a refrigerated environment to the laboratory of Nobel Laboratory Research Center Isfahan, Iran, for further analysis. The samples were inoculated on Eosin Methylene Blue, Müller Hinton Agar, and Blood agar media (Himedia, India) and were incubated for 24 hours at 37 °C. Based on morphological and standard biochemical tests, all isolates were identified as A. baumannii. The isolates were then preserved in a Brain Heart Infusion (BHI) Broth medium from Oxoid, UK, supplemented with 20% glycerol, and stored at −70 °C until additional examination.

2.2. Antibiotic susceptibility testing

Antibiotic susceptibility of all isolates was evaluated using the Kirby-Bauer disc diffusion technique on Muller Hinton agar (MHA) plates, as per the guidelines of the Clinical and Laboratory Standards Institute (CLSI) [11]. Different antibiotics including gentamicin and amikacin, ciprofloxacin, cefepime and ceftazidime, meropenem, piperacillin/tozabactam, ampicillin-sulbactam, and trimethoprim-sulfamethoxazole were applied to characterize the antibiotic susceptibility profile of A. baumannii isolates. The MIC of colistin was detected by the automated system (Phoenix; BD Diagnostic Systems, Franklin Lakes, NJ, USA). Escherichia coli ATCC 25922 was utilized as the control. Antimicrobial susceptibility of strains was evaluated according to the CDC and ECDC definition, and categorized as MDR or XDR.

2.3. DNA extraction and visualization

All isolates that were confirmed to be resistant to colistin based on their phenotype were selected to the standard Genomic DNA extraction for subsequent molecular analysis. [12]. The quality of the DNA extraction was assessed on a 1.5% agarose gel.

2.4. PCR analysis of pmrCAB genes

According to Table 1, the pmrCAB genes were amplified via conventional PCR with gene-specific primers The PCR process involved the following cycling settings: 1 cycle at 94 ºC for 10 minutes, 25 cycles at 94 ºC for 45 seconds, 58 ºC (for pmrA) and 57 ºC (for pmrBC) for 45 seconds, 72 ºC for 45 seconds, and a finally at 72 ºC for 10 minutes.

Table 1.

Oligonucleotide sequences used in this study

PrimerPrimer sequence (5ʹ to 3ʹ)Amplicon sizeAnnealing temperature
PmrA(F)GATGGTTTAAATTTGGGTGCAGAT12058
PmrA(R)TTGACTCGCAAGTTGAGCTTCT
PmrB(F)GCCATTATTCGTCGTGGTTTAAA15057
PmrB(R)GCGCTCAAAAAGACGGTTCA
PmrC(F)CCATTTGGCTAGGTGCAATTT13257
PmrC(R)CCGCATAATAGGTAGCAACAAG

On a 1.5% agarose gel stained with Safe Stain and viewed under an ultraviolet transilluminator, the results of the amplified target of the specific gene were examined.

2.5. pmrCAB sequence confirmation and analysis

An external expert service provider (Macrogen, Korea) utilized Sanger sequencing to perform the sequencing of the PCR products. The NCBI’s Basic Local Alignment Search Tool was used to compare the sequences, and Oligoanalyzer software was used to analyze their properties and the possibility of forming secondary and dimer structures. The eight isolates’ pmrA, pmrB, and pmrC gene sequences were compared to the reference sequence of A. baumannii ATCC 19,606 (GenBank: CP045110.1) available at the National Center for Biotechnology Information website.

3. Results

A total of 108 Acinetobacter isolates were obtained from teaching hospitals, with 70% of the strains being from hospitalized patients in ICUs and comprising 58 females and 50 males with an average age of 53 ± 21 years. PCR amplification of the blaOXA-51-like gene confirmed that all of the strain were A. baumannii.

The A. baumannii isolates were derived from various sources, including blood (41.9%), urine (29.03%), respiratory secretions (19.35%), and ulcer swabs (9.6%). The antibiotic susceptibilities of A. baumannii isolates are presented in Figure 1. Overall, all isolates showed resistance to at least one antibiotic, with piperacillin/tazobactam, meropenem, and ciprofloxacin being the most commonly resistant antibiotics (100%). The two most effective antibiotics were colistin (84.5%) and amikacin (9.25%). In addition to β-lactam drugs, the isolates exhibited high resistance to most antimicrobial agents, including meropenem (100%), ceftazidime (98.1%), and gentamicin (94.4%). All isolates were classified as XDR, with seven isolates being pan-drug resistant (PDR). Out of 108 isolates, 7 (6.5%) were resistant to colistin, with a MIC breakpoint of ≥ 4 mg/L (CLSI). Despite the use of this antibiotic as the last line of treatment, all patients died during hospitalization.

Figure 1.

The results of antimicrobial susceptibility of A. baumannii to the antibiotics investigated in this study. Overall, piperacillin/tazobactam, meropenem, and ciprofloxacin were the most commonly resistant antibiotics (100%). The two most effective antibiotics were colistin (84.5%) and amikacin (9.25%). SAM: Ampicillin-sulbactam; TZP: piperacillin/tozabactam; CAZ: Ceftazidime; FEP: cefepime; MEM: Meropenem; GM: Gentamicin; AN: amikacin; CIP: ciprofloxacin; SXT: Trimethoprim-sulfamethoxazole; and CL: Colistin

PCR screening of the pmrCAB genes was performed on seven A. baumannii isolates that were resistant to colistin (Figure 2). The results showed that all seven colistin resistant isolates were positive for pmrCAB genes, which Nucleotide BLAST results showed the 97–100% sequence similarity to the sequences of the pmrCAB genes present in GenBank. In addition, four isolates showed a substitution (3276848 T>G) in pmrB and two isolates showed a substitution (3279660 G>A) in pmrC.

Figure 2

PCR amplification of the PmrA, B and C genes. Ladder: 100 bp-2kb ladder, lane 1: positive control for PmrA (120bp), B (150bp) and C (132bp) genes; lane 2–9: positive results and negative control

3.1. Nucleotide accession numbers

The accession numbers for the deposition of nucleotide sequences of pmrCAB genes in A. baumannii to GenBank are as follows: ON777415, ON820656, ON820662, ON820657, ON820663, ON820659, ON820660, ON820658 ON820661, ON820664, ON820665, ON820666, grp 8647008, ON921023, ON959503, ON959504, ON959505, ON959506, ON959507, ON959508, ON959509, ON971458, and ON971457.

4. Discussion

The resistance of A. baumannii to drugs is spreading rapidly worldwide, and there are multiple factors that contribute to this phenomenon, including the misuse and overuse of antibiotics [13]. Colistin is one of the few available treatments for a variety of infections due to the emergence of carbapenem-resistant isolates [14]. Although, colistin is a last choice agent used to treat infections caused by MDR strains of A. baumannii, the emergence and rise of CoR has become a major challenge in the clinical management of A. baumannii infections [15]. In Iran, the increasing prevalence of A. baumannii poses a critical threat to healthcare, and colistin has become a last-line antibiotic [16,17,18].

The results of our research indicate that there is a high prevalence of XRD-A. baumannii isolates in Iran, which is in line with other studies conducted previously [19,20]. Additionally, our study emphasizes the severity and importance of XDR in A. baumannii, particularly in ICU patients, as most of the isolates tested showed antimicrobial resistance.

The study found that carbapenem resistance was common, with all isolates showing resistance to the tested carbapenems. These findings are consistent with those reported in different parts of the world, and they demonstrate the increased risk of carbapenem treatment failure in A. baumannii infections [21,22,23].

The lowest frequency of resistance was assigned to colistin (6.5%), which belonged to seven PDR A. baumannii with MIC values ≥4 μg/ml. None of piperacillin/tazobactam, meropenem, ciprofloxacin were susceptible in treatment of the isolates. In comparison to other antibiotics tested, colistin is still the most effective treatment for A. baumannii infections, according to research [24]. Our findings are in line with studies that show about 7% of A. baumannii isolates are resistant to colistin [25,26]. Nonetheless, a different study reported that CoR was observed in 57% (12/21) of the A. baumannii isolates, with MIC levels ranging from 4 μg/ml to over 128 μg/ml (9).

Studies conducted earlier have suggested that the primary reason for CoR in A. baumannii is due to changes in the outer membrane caused by mutations in genes such as pmr, lpx, lpsB, lptD, and vacJ, the presence of mcr genes on plasmids, or other mechanisms not related to outer membrane changes such as enhanced sensitivity to osmotic pressure or the action of efflux pumps [27,28].

The development of CoR in A. baumannii is significantly influenced by the pmrCAB genes. Understanding the role of pmrCAB genes in colistin-resistant A. baumannii is critical for developing new strategies to combat antibiotic resistance [29,30]. Researchers are exploring different approaches to target these genes, such as the use of small molecule inhibitors or phage therapy, in order to restore the efficacy of colistin and other antibiotics against A. baumannii infections [31].

In our study, we detected all seven A. baumannii isolates carrying the pmrCAB gene. Furthermore, we conducted genome sequencing to investigate the existence of antibiotic resistance genes and mutations that are associated with colistin resistance. Using this approach, we found some mutations in pmrB and pmrC among seven isolates.

On the other hand, earlier research has documented that mutations in pmrCAB genes are linked to heightened expression of pmrC, and some of these mutations emerged while undergoing colistin therapy [32,33]. The pmrA/pmrB system, which consists of two components, controls the expression of pmrC and mutations in pmrAB which may cause an increase in pmrC expression. However, it is possible that other mechanisms of CoR are present and should not be disregarded [34,35].

Additionally, the findings of the sequence similarity search in this study revealed a similarity rate of 97–100% when compared to the reference strains, specifically ATCC 19606. Overall, in this research, it was determined that the presence of pmrCAB gene mutations in Iranian patient-derived CoR isolates may be responsible for the emergence of colistin-resistant strain. In our study, there were no mutations in pmrA consistent with the previous studies indicating a lack of correlation between CoR and incidence of mutation in the pmrA gene [18]. Additionally, Babaei et al. demonstrated that there were no mutations detected in the pmrCAB genes when the PCR amplicon was analyzed [17].

Similar to our results, Seleim et al. also documented the occurrence of the same substitution in a colistin-resistant isolate of A. baumannii [32]. Gerson et al. observed that only the colistin-resistant bacteria had five amino acid substitutions that are unique and specific to the pmrB gene, namely S128R, T42P, L153F, A28V, T42P, and P170L. These substitutions were found to be linked to colistin MIC levels ranging from 8 mg/L to ≥256 mg/L[36]. Also, previously in Iran, Farajnia et al. had earlier reported the presence of the V162A substitution within the pmrB gene in two bacterial isolates from Iran [18].

Based on these findings, it appears that the resistance of A. baumannii is constantly evolving. Therefore, it is crucial to implement an appropriate treatment plan and a precise strategy in order to prevent infections that originate from this bacterium in hospital settings. The PDR susceptibility profile data of A. baumannii emphasizes the critical importance of a comprehensive and widespread national program for the study of antimicrobial drug resistance in Iran, which is responsible for monitoring A. baumannii isolates from diverse regions of the country for a serious nationwide effort to control and manage the outbreak of PDR A. baumannii [37].

4.1. Limitations of the study

This study is subject to certain limitations: the primary limitation pertains to the incomplete availability of comprehensive patient history background information. Furthermore, it is imperative to acknowledge that the isolation of A. baumannii strains was confined to different hospitals, necessitating a cautious approach to the interpretation of the results. Second, the impossibility of using typing methods such as pulsedfield gel electrophoresis (PFGE), therefore, to identify the source for pathogen transmission and take preventive measures in a hospital setting, molecular analysis of clinical specimens was required.

5. Conclusions

In conclusion, this study is the initial report of the existence and mutations of pmrB and C genes in a clinical isolate of A. baumannii in our region. This outcome highlights the necessity to explore additional mutations in the PMR operon of A. baumannii in forthcoming studies. Moreover, our results highlight the high occurrence of XDR-A. baumannii isolates in Isfahan, Iran, and the urgent need for actual strategies to prevent and control the spread of these infections.

Notes

[1] Contributed by Authors’ contributions

Conceived and designed the experiments: DSh and AA; Performed the experiments: AA and BH; Performed statistical and spatial analyses and interpreted all the results: DSh and AA; Contributed to the writing of the manuscript and revised the final version manuscript: AA, BH, and DSh; All authors read and approved the final manuscript.

[2] Funding

This study was financially supported by a grant from Shahid Ashrafi Esfahani University, Isfahan, Iran

[3] Conflicts of interest Conflict of interest

The authors declare that there are no conflicts of interest.

[4] Ethics approval

Ethics Committee approval was not required. Investigated clinical samples were leftover materials from other studies.

Language: English
Page range: 52 - 57
Submitted on: Jun 2, 2023
Accepted on: Jan 10, 2024
Published on: Apr 28, 2024
Published by: Hirszfeld Institute of Immunology and Experimental Therapy
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year

© 2024 Ali Abbasi, Bahareh Hajihashemi, Dariush Shokri, published by Hirszfeld Institute of Immunology and Experimental Therapy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.