Skip to main content
Have a personal or library account? Click to login
Salivary HPV infection in healthy people Cover

Full Article

1
Introduction

In recent years interest has grown in human papillomavirus infections as a causative factor in epithelial cancer development [1, 2, 3, 4, 5]. Human papillomavirus is part of a larger DNA virus family, the Papillomaviridae. They are built up from double-stranded DNA. So far more than 100 HPV genotypes have been described. They are divided into two groups: high and low oncogenic risk. Among low-risk HPVs we can distinguish, e.g., HPV6, HPV11, HPV1, HPV2. High-risk HPVs such as HPV16, HPV18, HPV31, HPV33, HPV45 are described as having high potential for malignant progression [4]. Almost 45 genotypes of HPV have been detected in cervical cancer [1]. The high oncogenic potential of some HPV genotypes is believed to be connected with two specific oncoproteins: oncoproteins E6 and E7, which are crucial for promoting viral transformation in epithelial tissue. Those two oncoproteins alter the function of genes p53 and pRb, which are responsible for tumor suppression. Both of those oncoproteins trigger proliferation and cell immortalization and induce genomic instability [4].

HPV occurrence is ubiquitous. The transmission of the virus is via direct contact. Sound skin or mucosa is resistant to its inoculation. Healthy individuals can be reservoirs for HPV. The incidence of HPV in not pathologically changed oral epithelium can vary from 0.6% up to 81%. This discrepancy is due to the DNA detection methods used, and the means of specimen acquisition. The oral cavity can be infected with HPV by autoinfection, during labor from an infected mother to a child, or by oral sex [6, 7, 8]. No evidence exists that HPV is an airborne virus.

Numerous publications indicate the association of HPV in the presence and development of oral mucosal lesions, such as oral squamous cell papilloma, condyloma accuminatum, Heck's disease, oral leukoplakia, verrucous leukoplakia, oral lichen planus (OLP), and oral squamous cell carcinoma (SCC) [1, 2, 3, 4, 5, 9, 10, 11, 12, 13].

Human papilloma virus as a cervical cancer factor has been widely proven, both biologically and epidemiologically [4]. But nowadays there is also greater interest in HPV as a causal agent in other epithelial regions, such as oral cavity diseases. Literature indicates that HPV involvement in malignant transformations in oral mucosa can range from 0 up to 87%. HPV16 considered as a high-risk genotype is the most prevalent HPV type in cervical squamous cell carcinoma; it is also the most detected HPV type in all head and neck SCC [1, 3, 5, 6, 7, 8].

The aim of our study was to detect the prevalence of salivary HPV infection among generally healthy adults.

2
Materials and Methods
2.1
Patients

The examination was performed on 139 patients in good general condition: university students, hospital staff, and members of the general public, without oral mucosal lesions. The oral cavity state was checked in a clinical examination. Subsequently after about fifteen minutes of rest, unstimulated saliva samples were collected into an Eppendorf tube by a dentist. All research participants gave written consent to take part in the study. The study was approved by the Wrocław Medical University Bioethics Committee (No. B-661/2018).

To provide full anonymity each of the patients was given an individual identification number.

2.2
DNA extraction

Saliva was collected by spitting into a sterile 1.5 ml Eppendorf tube; samples were stored at −24°C until testing. Before molecular biology analysis, obtained saliva samples were thawed on ice. DNA isolation was performed, using a modified CTAB (cetyltrimethylammonium bromide) method, the prototype of which is included in the publication of Song et al. [14]. The changes made during the study were made to adapt to the laboratory's conditions and available equipment. As an internal control of the DNA extraction, samples with DNA were subjected to endpoint PCR for human β-globin gene amplification, by using GH20 5′ (GAAGAGCCAAGGACAGGTAC)3′ and PCO4 (5′TCACCACAACTTCATCCACGTTCACC3′) oligonucleotides, which flank a sequence of about 268 pb. Samples that were positive for human β-globin gene were subjected to viral DNA search for HPV. After reanalyzing samples for confirmation only negative samples for β-globin gene were excluded from the analysis.

2.3
HPV DNA amplification

In our study HPVs were detected by nested PCR. This PCR required two different, conventional pairs of oligonucleotide primers to detect HPV: MY09/MY11, GP5+/GP6+, one by one. The PCR reaction mixture was prepared according to well-defined proportions of reagents. A sample calculated per one reaction was: 25 μL DreamTaq Green PCR MasterMix (Thermo Scientific), 18.75 μL Water nuclease free (Thermo Scientific), 1.25 μL of primers at a concentration of 20 pml/μL and 5 μL suspension of isolated DNA from saliva. For each series of samples subjected to nested PCRca, a positive control sample and also a negative control sample (H2O) were carried out. Positive control material contained purified genomic HPV type 16 DNA suspension: Amplirun Papillomavirus DNA Control Sample (Vircell Microbiologists) at concentration 1000 copies/of genomic HPV DNA. The temperature and conditions of nested PCR were adjusted to the recommendations of the manufacturer's Dream Taq Green PCR Master Mix and the melting temperatures of the primers (Table 1). The amplified genetic material was subjected to electrophoresis for several hours from the time of isolation, and until then kept in a refrigerator at 4°C.

Table 1

Conditioning protocol of nested PCR technique using primer pairs: MY09/11 and GP5+/6+

Set primersReaction stepTemperature, °CDurationNumber of repetitions
MY09/11Initial denaturation953 min-
Denaturation9530 s40×
Hybridization of primers5330 s
Amplification DNA7245 s
Final amplification725 min-
-4-
GP5+/GP6+Initial denaturation945 min-
Denaturation941 min30×
Hybridization of primers482 min
Amplification DNA721 min
Final amplification725 min-
-4-
2.4
Electrophoresis reaction

To visualize the PCR products, an electrophoresis reaction was carried out in a 2% agarose gel in the 1 × concentrated TAE mixture (242g Tris pH 8.3; 100ml 0.5 M EDTA pH 8; 57.2ml CH3COOH per 1000 ml) in the presence of MIDORI Green Advance DNA Stain (NIPPON Genetics EUROPE GmbH). For the number of base pairs a standard DNA GeneRuler 100 bp DNA Ladder (Fermentas, Thermo) was used. Visualization of electrophoresis results was performed under UV light with the use of Gel DOC EZ Imager, BioRad.

3
Results

The research material consisted of 139 saliva samples, from 139 patients: 57 women and 82 men, aged between 19 and 74 years. Sample analysis showed that DNA-HPV was detected in 14 patients: 11 positive results were obtained from men, and 3 from women. Mean patient age was 32. The study revealed that the most commonly HPV DNA was detected in subjects between 19 and 39 years old. Genetic material of the virus was detected in 12 samples from subjects in this age range (Table 2).

Table 2

Total sample description and detection of DNA-HPV in relation with gender and age groups

Patientsn=139Positive HPV resultn=14
Male8211
Female573
19–39 years old10612
40–59 years old90
60+ years old242
4
Discussion

Numerous studies have assessed the prevalence of human papillomavirus in the oral cavity. HPV was detected in various oral specimens collected from saliva, oral rinse samples, gargle with mouthwash samples, epithelial cells after exfoliation, from different pathological oral lesions, and even from healthy, asymptomatic oral mucosa. In these studies the occurrence of the oral HPV infection was sometimes completely different, ranging from 1.9% up to 10% [15]. This could be explained by the use of other DNA extraction methods, different populations with low or high risk for the infection, populations from different geographical regions, and of course because of different sample collections [12, 14, 16, 17, 18].

Saliva samples have many advantages: they can be provided easily, without invasive procedures, in a short time and are safe for the patients. Their collection takes only few minutes, and the obtained sample has the right volume for further testing.

In our study collection of 1.5ml of whole saliva took about 7 minutes in patients with proper salivary flow. In order to check the frequency of asymptomatic HPV infections, 139 healthy people were qualified for the study – e.g., without immunodeficiency, not organ recipients, not during immunosuppressive therapy. This is due to the fact that the frequency of infections, including HPV, among people with a disturbed immune system could be significantly higher than in healthy people of the same age. The average patient's age was 32 years. We estimated general HPV infection for all HPV types.

14 samples out of 139 revealed positive results for HPV: this is a high infection rate, at the level of 10.07%. A bit lower levels of HPV infection were presented by other research for all types of HPV in healthy individuals: 7.7% in the meta-analysis of 66 studies done by Tam et al. [19], 7.5% in the work of Wood et al. [20] in which 3762 individuals were included. However, a lower frequency (6.9%) was demonstrated in the work of Gillison et al. [8] with 5579 participants, and prevalence of 5.5% in the meta-analysis of Shigeishi and Sugiyama [21] of 29 studies with 22,756 individuals. A case-control study conducted in England by Hearden et al. [22] in a mixed population of 700 participants, incorporating university students, hospital staff, dental patients, and the general public, the prevalence of oral HPV was 5.5%, while in a meta-analysis of 48 reports comprising 28,544 subjects Mena et al. [23] reported even lower infection frequency, at 4.9%.

In our research group there were 59% males and 41% females. It is worth underlining that HPV prevalence in the male group was more twice as high (13.41%) as in the female group (5.26%).

Similar observations have been presented in other studies. Sonawage et al. [8], on the basis of a large representative population of 11 million men and 3.2 million women, found that the prevalence of HPV infection was three times more frequent in males than in females: 11.5% and 3.2% accordingly. Similarly on the basis of a USA cross-sectional study of a large number of participants (5579), Gillison et al. [17] revealed 3 times higher HPV infection prevalence in men (10.1%) when compared in women (3.6%).

When the age of participants was taken into account, the observation was also very interesting. The group of people between 19 to 39 years old constituted 76.26% of all of the participants; HPV infection was detected in 11.32% of them, the highest rate.

The increase in HPV infections in the age group 19–39 could be related to the increased sexual activity of individual people in this group. It is well known that HPV infections are transmitted mainly through sexual contact, which is not limited to genitalgenital relations, because they can also be genital-manual, genital-oral, or genital-anal.

None of the subjects in the middle-aged group (40–59 years old), 6.67% of the entire group of patients, had the HPV infection. In turn, senior patients (≥60 years old), 17.26% of all of the study subjects, revealed HPV infection at the level of 8.33%.

Similar findings were also demonstrated by other authors, where the HPV infection prevalence peak was observed among young people aged 30 to 34 years old (7.3% infected), and elders 60–64 years old (11.4%) [17].

On the one hand, our findings and those of others prove the frequent presence of HPV infections in the oral cavity, which can be mostly asymptomatic. On the other hand, mucosal lesions related to HPV infections are observed as focal epithelial hyperplasia, oral papillomas, oral warts [11, 15]. These pathological lesions are not common and have no carcinogenic potential, as they are related to low-risk HPV types such as HPV6, 11, 13, 32. In the context of the potential role of HPV as promoter of the malignant transformation of precancerous oral disorders this hypothesis is still equivocal.

The occurrence of HPV infection in oral mucosal lesions is also not clear. De Abreu et al. [24] investigated the status of HPV in a cohort of 90 biopsied oral squamous cell carcinomas (OSCC) of Brazilian patients. Study showed a low 3.3% frequency of HPV infection and detection of HPV16 in all of the cases, which is the most common type. Additionally, his study revealed that in pre-malignant non-homogeneous leukoplakias HPV was found less frequently than in homogenous types, which are considered to have better prognosis due to lower levels of malignancy. However, oral leukoplakia shows an increased risk of HPV infection when compared to clinically healthy mucosa, with its prevalence of around 20% [9].

Other meta-analyses also indicated no clear association between HPV infection and oral squamous cell carcinoma, but proved this association with oropharyngeal SCC [2, 9]. The latest published study pointed out a relation between tumor p-16 expression and oral HPV16 infection in oropharyngeal cancer [25].

Finally it must be emphasized that there are many risk factors contributing to oral malignancy development. HPV infection may not be the most important one, but may be overlapping or inducing the other local and general factors. It is well known that HPV is the most common sexually transmitted infection. Its transmission to the oral cavity, and the enhancement of the risk of premalignancy and development of oral cancer, is increased in women with cervical infection that confirms the possible transmission between oral cavity and genitals.

Oral HPV infection is significantly higher, more than 10%, in women with cervical infection than in the general population of healthy women without cervical infection. The study of Cossellu [6] reports the presence of oral infection in 20.4% of women with gynecological infection.

This study has limitations, because there are no additional parameters that could be taken into consideration when the assessment of the risk factors for HPV infection is conducted.

On the other hand, we focused on saliva as a very convenient sample to detect viral infection. Current outcomes of Tang et al.'s [25] research clearly support the knowledge that HPV detection in saliva can be a biomarker to confirm this infection in the oral cavity in every suspected case.

5
Conclusions

In our research the prevalence of HPV infection detected in whole saliva was a little higher than in studies conducted by cited authors. This study showed that subclinical oral HPV infection is present more often in men than in women. It was also more frequently seen in the young and in elder people. Our results propose that dental practitioners should have the knowledge of HPV risks and involve themselves in the early detection of all the oral mucosal lesions associated with HPV infection.

Language: English
Page range: 143 - 148
Submitted on: Dec 30, 2020
Accepted on: Aug 11, 2021
Published on: May 29, 2022
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year

© 2022 Małgorzata Radwan-Oczko, Joanna Owczarek-Drabińska, Anna Szczygielska, Marta Szczepaniak, Irena Duś-Ilnicka, published by Hirszfeld Institute of Immunology and Experimental Therapy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.