Skip to main content
Have a personal or library account? Click to login
The association of air pollutants (CO2, MTBE) on Candida albicans and Candida glabrata drug resistance Cover

The association of air pollutants (CO2, MTBE) on Candida albicans and Candida glabrata drug resistance

Open Access
|Jun 2022

Full Article

1
Introduction

Air pollution has become a major environmental challenge facing humanity in this century. Many agents, such as environmental elements, play an important role in human life. Geographical conditions, temperature, humidity, and pollution also have a major effect on the health or illness of humans and are considered to be a global threat [1].

Allergic syndrome, hypersensitivity syndrome, inflammation of paranasal sinusitis, itching, respiratory infection, and many other diseases have resulted from these elements. In this way, pollution has an impact on eukaryotic and prokaryote cells, and on humans [2]. Correspondingly, Candida is a prevalent micro-organism in the reproductive and gastrointestinal mucosa that can be isolated from the oral cavity. For this reason, most of the healthy population are susceptible to the most prevalent fungal infections such as candidiasis. Candida species generate infections ranging from superficial diseases as well as systemic infections, especially in immunocompromised patients [3]. More than 150 species of Candida have been identified, but few were known to cause infections in humans, including C. albicans, C. krusei, C. glabrata, C. tropicalis, C. parapsilosis, C. lusitaniae, C. dubliniensis, C. kefyr, C. guilliermondii, and C. stellatoidea [4]. Among all of these, C. albicans is the most pathogenic; C. glabrata is considered to have the highest frequency of drug resistance among all non-C. albicans species [5]. After C. albicans, C. glabrata is the most prevalent agent of mucosal and disseminated candidiasis in adults [6]. C. albicans generate extremely organized biofilms consisting of various cells, such as round, budding yeast-form cells; oval pseudohyphal-cells; long, cylindrical hyphal-cells enclosed in an extracellular matrix [7]. Presently, biofilm infection happens in more than 50% of these catheters even with newly enhanced clinical procedures, and these infections can cause serious health and financial implications. As fungal biofilms are mainly resistant to currently used antifungal drugs, the treatment of diseases usually takes higher doses of antifungals with removal of colonized medical devices [8]. In recent years, extensive studies have been performed on many virulence factors in C. albicans, including hyphal formation, phenotypic switching, and extracellular hydrolytic enzyme production. Hydrolytic enzyme production, which is recognized as one of the key agents in yeast pathogenicity, is a factor contributing to the process of virulence. Among the different types of hydrolytic enzymes found in microorganisms, the most common ones related to virulence are proteinases [9]. Secreted aspartyl proteinases (SAP), phospholipase B enzyme, and lipases are the most important extracellular hydrolytic enzymes produced by C. albicans [10]. The expression and regulation of 10 SAP genes increases the number of questions regarding the role and impact of these proteinases throughout the infection procedure. Temporary activation of 10 SAP genes throughout the various infection phases provides that parts of this gene family have an important function in C. albicans’ response to the surroundings, especially its host [11]. Stresses and environmental agents, geographical condition, temperature, humidity, and pollution are associated with the presence of CO2; MTBE is present due to unusual use of synthetic agents such as fuel, paint or polish. Many other environmental factors such as CO2 and O2 concentrations in high doses, PH, and other parameters can contribute by changes in normal growth, virulence factors, hydrophobicity, biofilm formation, secretory enzymes, and alteration of fungal drug resistance and other factors that relate to microorganisms [12].

Nowadays air pollution has affected many organisms such as fungi, and has created many changes in their features. One of these pollutants is MTBE (methyl tert-butyl ether), used as a fuel additive to improve and reduce greenhouse gases and other hazardous pollutants, used instead of lead in gasoline all around the world. This substance has a very high solubility that has a high risk for contamination of drinking water [13]. The addition of MTBE improves the physical characteristic of liquid fuels (used at 15% by volume). MTBE has aqueous solubility (>5 g L−1), low sorption to soil and sediments, and volatile. Some microbial genera can use the compound and metabolize MTBE completely to CO2; it is used as a carbon source by some prokaryotic organisms [14]. To find out the relation of CO2 and MTBE exposure and drug resistance identification, the effects of CO2 and methyl tertiary butyl ether (C5H12O-MTBE) concentration on C. albicans and C. glabrata growth and their virulence factors, this project was accomplished.

2
Materials and Methods
2.1
Candida isolation

In this study, clinical isolates obtained from two hospitals (Imam Khomeini and Shariati Hospitals, Tehran, Iran) were used. Previously isolated samples maintained in mycology collection in the school of public health at Tehran University of Medical Sciences, and standard strains of C. albicans (ATCC10231) and C. glabrata (ATCC90030) were involved as well.

About 105 patients with cutaneous, mucous, and deep infections of candidiasis were obtained in 2016–2017 from the mentioned centers. The samples included: nails, sputum, stool, BAL, groin, skin, and mouth. We investigated 33 samples of C. albicans and 17 samples of C. glabrata which were obtained from different locations in the patient’s body. All samples were then cultured on SDA (sabouraud dextrose agar, Sigma) and incubated at 35 °C for 48 hours.

2.2
Morphological identification

All obtained yeasts were detected by morphological and molecular trends. For morphological identification, we used CHROMagar Candida medium (Paris, France) to identify C. albicans from multiple other Candida species based on the colors produced after 48 h of incubation. All yeast samples that were identified as non-albicans on the CHROMagar Candida medium have been forwarded for molecular identification by RFLP-PCR.

Besides, RFLP-PCR was utilized for verifying the identification of C. albicans and C. glabrata species used in this study.

2.3
Molecular identification
2.3.1
DNA extraction

For DNA extraction, 103 cells/ml of all isolates from fresh colonies were harvested, then the glass bead disruption method was done. Briefly, cultured yeasts were dissolved in 1.5 ml micro-centrifuge tube and 300 mg of 0.5 mm diameter glass beads, 300 μl of lysis buffer (100mM Tris-HCl pH 8, 10 mM EDTA, 100 mM NaCl, 1% sodium dodecyl sulphate), and 300 μl of phenol chloroform-isoamyl alcohol (25:24:1) were added. Then all samples were shaken for 5 min, centrifuged for 5 min at 5000 rpm. The supernatant was transferred to a fresh tube and extracted again with chloroform. High molecular weight DNA was precipitated by adding the same volume of isopropanol and 0.1 volume of 3 M sodium acetate (pH 5.2). After that, the solution was completely vortexed and incubated for 10 min at −20° C and centrifuged for 15 min at 12000 rpm. The precipitant was washed with ice-cold 70% ethanol, dried in the air, dissolved in 50 μl of double distilled water, and stored at −20° C until used for complementary identification of isolates.

Then for detection of Candida species, the RFLP method was applied by amplification of ITS1-5.8S-ITS2 of fungal rRNA genes fragment using ITS1, ITS4 universal primers (ITS1: 5′ TCCGTAGGTGAACCTGCGC 3′, and ITS4: 5′ TCCTGGGCTTATTGATATGC 3′) and the Msp1 restriction enzyme (Fermentas, Germany). Briefly, 2.5 μl of 10× PCR buffer with MgCl2, 0.4 mM of dNTP mix, 1 μl of Taq polymerase, 2 μl of DNA template were used for PCR. The PCR amplification was performed in Veriti 96 Thermal Cycler (Applied Biosystems, USA) based on the program: initial denaturation at 94° C for 3 min then 40 cycles at 94° C for 20 s, 55° C for 30 s and 72° C for 45 s, and subsequently final extension at 72° C for 5 min. The PCR amplicons were resolved with DNA markers in 2% agarose with ethidium bromide (0.5 μg/ml) by gel electrophoresis and for definition, Candida isolates. The PCR product was digested by Msp1 enzyme. Obtained C. albicans and C. glabrata species were selected to continue the procedure.

2.3.2
MIC (minimum inhibitory concentration) of two azole drugs

This test was performed based on broth microdilution Clinical and Laboratory Standard Institute (M27A4) method of CLSI with RPMI1640 (Gibco, USA). Briefly, Candida species were harvested from 24–48 hours of SDA culture and diluted with sterile phosphate buffer saline (PBS) to prepare 1- 5 × 103 CFU/ml by spectrophotometer (530 nm). MIC tests were then conducted based on CLSI protocol for fluconazole and itraconazole antifungals (Janssen Research Foundation, Beerse, Belgium). Drugs were used as reagent-grade powders dissolved in dimethyl sulfoxide (DMSO) and diluted in RPMI 1640 medium (Sigma-Aldrich, St. Louis, MO, USA) buffered to pH 7.0 with 0.165 mol · L−1 morpholine propane sulfonic acid buffer with L-glutamine without bicarbonate (MOPS, Sigma-Aldrich, St. Louis, MO, USA).

Only sensitive isolates were selected for being confronted with interference agents. We have had the same condition of CLSI protocol for all samples before and after they were confronted with the interference agents CO2 and MTBE.

2.4
Interference agents
2.4.1
CO2

CO2 atmosphere was provided by using a 20-L cell culture CO2 incubator (SLS, USA). The amount of CO2 injection was monitored by the calibrated automatic control panel in this incubator.

In this study, we cultured all samples (30 samples) on SDA medium and incubated them at 37° C in a 5% CO2 incubator for 1–4 weeks alternatively. Simultaneously, the samples were also cultured in the same condition without CO2 for comparing the obtained morphological results.

2.4.2
MTBE

In this study, all samples were cultured on SDB containing 5 mg/ml MTBE and incubated at 37 degrees for 1–4 weeks alternatively.

2.5
Determination of MIC after treatment by CO2 and MTBE

Alternatively, isolates were confronted with CO2 and MTBE for four weeks. MIC tests were repeated to detect possible resistances to fluconazole and itraconazole. The same condition described previously was followed for MIC and all tests were performed in duplicate.

2.6
RNA extraction

The RNA molecules were extracted by the RNX-plus kit (Sinaclon Co., Iran) from all Candida species which gained resistance after being confronted with CO2 and MTBE. Briefly, 103 cells/ml from fresh colonies were prepared and treated with the isolation re-agent. The quantity and quality of the extracted RNA were then confirmed by absorption measurement at 260 and 280 nm using the spectrophotometer (Beckman Coulter, CA, USA) and electrophoresis on 1% agarose gel. The extracted RNA was stored at −80° C and used for cDNA synthesis with easy cDNA reverse transcription kit (Sinaclon Co., Iran) according to the instructions.

2.7
Real-time PCR after effect of agents

The obtained cDNAs were then utilized in real-time PCR assay with specific primers and by using AMPLICQON (Real Q plus 2x master mixes Green High Rox) in the ABI one step (Biosystems, Rotkreus, Switzerland) instrument. The mixture contained 10 µl of master mix (Green High Rox), 1 µl of each specific primer (ERG11, CDR1, HWP1, EPA1, SAP1-3), and 2 µl of each cDNA sample. The mixture was adjusted to the final volume of 20 µl applying DEPC water. The program of real-time PCR was as follows: initial denaturation at 95° C for 2 minutes and followed by 40 cycles including in 95° C for 20 seconds, 59–60° C for 20 seconds, and 72° C for 30 seconds.

2.8
Primers

The specific primers (ERG11, CDR1, HWP1, EPA1, and SAP1-3) were designed by applying all-ID design software (Table 1) [15, 16, 17, 18, 19, 20].

Table 1

Sequences of primers used in Real-time PCR reaction in C. albicans and C. glabrata

GenePrimerSequence (5′->3′)
Sap1ForwardTGGGTTCCTGATGCTTCTGTT
ReverseTCGGCAAAGACTTGCTTTGTG
Sap2ForwardGGGGACATATGATCCAAGTGGT
ReverseCCACCGGCTTCATTGGTTTT
Sap3ForwardATGTTACTGGTCCCCAAGGTG
ReverseCCTTGACCAGCTTGACATGAA
HWP1ForwardAATCATCAGCTCCTGCCACTG
ReverseGTCGTAGAGACGACAGCACTA
CDR1ForwardGGTGCTAATATCCAATGTTGG
ReverseGTAATGGTTCTCTTTCAGCTG
EPA1ForwardGGTCACTTACCCGCAAGCTA
ReverseCCAGATGGCGTAGGCTTGAT
ERG11ForwardGAGATTGCACCACCCATTGC
ReverseTGGAGATAGCACCGAAACCG
β-actinForwardACGGTATTGTTTCCAACTGGGACG
ReverseTGGAGCTTCGGTCAACAAAACTGG

The β-actin gene was used for the optimization of the real-time PCR as a housekeeping gene. The reactions were performed in duplicate and the analysis was done by REST2009 software.

3
Results

The effect of MTBE and CO2 on drug sensitivity and some virulence factors in C. albicans and C. glabrata were assessed. C. albicans and C. glabrata isolates were then recognized based on the result of morphological and molecular tests. The CHROM agar candida medium was applied for morphological diagnosis and C. albicans with green color and C. glabrata with pink color were selected. Performed molecular complementary identification based on RFLP-PCR revealed all 105 isolated as C. albicans and C. glabrata. The total of 105 Candida species which were isolated from different sources of candidiasis involved patients in the mentioned hospitals, which are shown in Table 2.

Table 2

Dispersion the sources of Candida isolates

Nature of specimenC. albicansC. glabrataOther spicesNumber of Candida spp%
BAL8381918.02
SPUTUM1310315451.42
NAIL6241211.42
MOUTH2-243.8
GROIN3-476.68
SKIN11465.81
STOOL-1232.85
Total331760105

The minimum inhibitory concentrations (MICs) against fluconazole and itraconazole were evaluated based on the M27-A4 method. Based on the obtained results, 20 samples of C. albicans and 10 samples of C. glabrata which were completely sensitive to both mentioned antifungals, were selected for continuing our research (Table 3, Figure 1). C. albicans selected sensitive species were isolated from BAL, sputum, mouth, skin, joint, and nail samples. C. glabrata selected sensitive species were isolated from BAL, stool, skin, and sputum samples. All these isolates were sensitive to both itraconazole and fluconazole. All 30 samples were cultured on SDA and SDB mediums simultaneously and were confronted with 5% CO2 and 5mg/ml MTBE respectively. The cultured media were then incubated at 37° C for up to 4 weeks and were tested for MIC after two and four weeks of incubation. The initial changes were observed after 2–4 weeks of confronting with mentioned agents, and the resistant isolates against fluconazole and itraconazole were then recognized. Regarding C. albicans, the species that grew in ≥8 µg/ml of fluconazole was mentioned as resistant. However, this concentration has been mentioned as ≥ 64 µg/ml for C. glabrata. Furthermore, the MIC criteria for being mentioned as resistant against itraconazole was ≥1 µg/ml in both C. albicans and C. glabrata (Table 4).

Fig. 1

Sensitivity pattern of C. albicans and C. glabrata

Table 3

Isolates of C. albicans and C. glabrata which were sensitive for both drugs with PCR-RFLP

TMML noSource sampleMIC (µg/ml) ItrMIC (µg/ml) FluCandida spp
TMML1BAL0.0160.125albicans
TMML2sputum0.252albicans
TMML3sputum0.1251albicans
TMML4sputum0.51albicans
TMML5mouth0.0161albicans
TMML6nail0.51albicans
TMML7nail12albicans
TMML8BAL0.0161albicans
TMML9nail0.0620.5albicans
TMML10groin0.0160.5albicans
TMML11BAL0.0160.5albicans
TMML12BAL0.0620.5albicans
TMML13sputum0.1250.25albicans
TMML14sputum0.1250.25albicans
TMML15sputum0.0160.5albicans
TMML16sputum0.0160.25albicans
TMML17skin0.52albicans
TMML18sputum0.1250.5albicans
TMML19groin0.0161albicans
TMML20sputum0.0310.5albicans
TMML21stool18glabrata
TMML22sputum0.58glabrata
TMML23sputum116glabrata
TMML24sputum18glabrata
TMML25sputum0.258glabrata
TMML26sputum116glabrata
TMML27sputum0.12516glabrata
TMML28sputum18glabrata
TMML29skin18glabrata
TMML30BAL0.0621glabrata
Table 4

MIC result after CO2 exposure and MTBE in C. albicans and C. glabrata

NoSppAfter 2 weeks with %5 CO2After 4 weeks with %5 CO2After 2 weeks with 5mg/dl MTBEAfter 4 weeks with 5mg/dl MTBE
FluItraFluItraFluItraFluItra
TMML1C. glabrata414122328
TMML2C. glabrata20.520.510.5162
TMML3C. glabrata20.540.50.51162
TMML4C. glabrata20.5410.50.25164
TMML5C. glabrata20.520.520.5164
TMML6C. glabrata40.564160.51322
TMML7C. glabrata20.520.50.50.0620.50.125
TMML8C. glabrata20.540.510.5324
TMML9C. glabrata41641611168
TMML10C. glabrata20.12564160.50.25322
TMML11C. albicans0.1250.0620.50.12510.4164
TMML12C. albicans64166416226416
TMML13C. albicans641664160.1250.1250.1250.25
TMML14C. albicans641664160.50.2510.25
TMML15C. albicans6416641610.25168
TMML16C. albicans64166416426416
TMML17C. albicans64166416226416
TMML18C. albicans0.0250.025641610.251616
TMML19C. albicans6416641610.2520.5
TMML20C. albicans641664160.50.510.5
TMML21C. albicans641664160.50.510.5
TMML22C. albicans641664160.250.2510.5
TMML23C. albicans6416641620.1256416
TMML24C. albicans641664160.510.50.5
TMML25C. albicans10.520.50.250.12520.5
TMML26C. albicans0.0620.03164160.250.1250.250.125
TMML27C. albicans10.25210.250.510.5
TMML28C. albicans641664160.250.0620.250.25
TMML29C. albicans641664160.51164
TMML30C. albicans641664160.250.0620.250.5

The resistant species of both C. albicans and C. glabrata were then tested for possible changes in gene regulation by RT-PCR. The results indicated the upregulation of biofilm-associated genes in 57.1% of the sensitive C. glabrata species which isolated from sputum and became resistant against both antifungals.

In this study, most species increased the expression of genes associated with biofilm formation. 58.8% of all C. glabrata samples were sputum samples. Among the sputum samples, 42.8% were sensitive to both drugs, while 57.1% of the sensitive sputum samples became resistant to itraconazole after exposure to only interfering agents. Furthermore, an increase in expression of the EPA1 gene has been observed in about 70% of such sensitive samples. Regarding ERG11 gene, upregulation and downregulation were observed respectively in 71% and 20% of resistant C. glabrata isolates. Increasing the gene expression in aspartyl pro-tease gene and decrease of gene expression in the SAP3 gene were observed in two groups, each consisting of 30% of C. glabrata isolates (Table 5, Figure 2).

Table 5

Expression of ERG11, EPA1, SAP3 genes in comparison with β-actin in C. glabrata

GeneTypeReaction EfficiencyExpressionStd. Error95% C.I.P(H1)Result
ERG11TRG1.00.8760.045 - 29.4450.000 - 123.6400.894
EPA1TRG1.064.6691.893 - 866.9490.438 - 8,060.4540.000UP
SAP3TRG1.00.7450.009 - 17.3870.000 - 434.2180.784
B-actREF1.01.000
Fig. 2

Total result of C. glabrata. genes expression (ERG11, EPA1, SAP3)

In C. albicans, in 30% of the resistant species against both drugs, an upregulation in the HWP1 gene was observed. Different changes in the regulation of other genes, which may be due to exposure to different interfering factors, were observed and revealed (Table 6, Figure 3).

Table 6

Expression of CDR1, HWP1, SAP1-3 genes in comparison with β-actin in C. albicans

GeneTypeReaction EfficiencyExpressionStd. Error95% C.I.P(H1)Result
CDR1TRG1.01.6230.160 - 20.9660.035 - 68.7810.342
HWP1TRG1.01.3000.069 - 21.8560.009 - 533.7420.702
SAp3TRG1.02.2980.471 - 20.1900.077 - 48.1760.042UP
Ssp2TRG1.04.5470.388 - 86.2230.007 - 849.2230.024UP
Sap1TRG1.02.2430.025 - 763.0310.000 - 12,429.9320.491
B-actREF1.01.000
Fig. 3

Total result of C. albicans genes expression (CDR1, HWP1, SAP1-3)

The result of biofilm formation for C. albicans and C. glabrata according to the effects of CO2 and MTBE is shown in Figures 4 and 5.

Fig. 4

Result of biofilm formation for C. albicans according to the effects of CO2 and MTBE

Fig. 5

Result of biofilm formation for C. glabrata according to the effects of CO2 and MTBE

4
Discussion

Candida species are considered the most important fungal yeast pathogen in immunosuppressed patients and other patients who use broad-spectrum antibiotics more widely. Candidiasis infections have increased in the recent decade and the causative agents may be affected by environmental changes such as CO2 concentration, SN, MTBE, and other elements of air pollution [21]. Environmental changes including osmotic shock, carbon source, and oxygen concentration can affect the fungal cell wall. The cell walls in C. albicans consist of two layers: inner and outer. The outer layer is composed of the mannan fibrillary layer, and the inner layer contains β-glucan and chitin [22]. The vulnerability of the mannan layer emerged in response to increasing the temperature from 37° C in the early stage of biofilm formation. Mild heat stress can cause an increase in the thickness of the mycelial inner cell wall at 39° C [23]. Candida lysin secreted by C. albicans hyphae has an essential role in supporting the complicated structures of mature biofilms [24].

Air pollution such as MTBE and high concentrations of CO2 (as an ubiquitous molecule) are among important environmental agents that threaten all living organisms, including yeasts. MTBE has been established as a human carcinogen by affecting oxidative stress and mitochondrial membrane and lysosomal membrane damages [13]. It has a negative effect on humans, such as a toxicity effect on human blood lymphocytes. This substance was used in liquid form with a purity of 99.9%. Evidently, the CO2 concentration in humans is higher than air. The amount of CO2 in the air is 0.03% and CO2 concentration in human bodies is 4.5–30%. Therefore, the CO2 content in humans is hundreds of times higher than in air. Recent research has reported that a low level of CO2 can cause changes in some virulence factors in the gene level [25]. CO2 is used for antimicrobial activity, especially the maintenance of foodstuffs, as it can impact microorganisms by inactivation of the cells.

However, in some countries, using MTBE is banned due to frequent soil and groundwater pollution by accidental spills from distribution systems and storage facilities. Butyl ether methyl is a gas additive that is added to increase the octane number and produced from methanol and iso-butylene. It is mainly used as a fuel oxygenating agent. The negative advantage of using this material is leak to surface and underwater minerals, but it is one of the major sources of contamination.

CO2 could affect fungal physiology, morphology, and pathogenesis, respectively; it could also affect allergenic properties in pathogenic fungi. CO2 concentration may also be considered an important pollution agent, affecting many features of yeast, which causes changes in its physiological and morphological characteristics. CO2 is stimulus-inducing for filamentation in C. albicans and formation of pseudohyphae in C. glabrata yeasts is stimulated by CO2 [26].

Kim and colleagues have indicated some changes occurred in Cryptococcus neoformans (synthase of polysaccharide capsule was increased) after exposure to 5% CO2 atmosphere. Based on previous studies, 5% CO2 atmosphere affected metabolism and pathogenesis of C. neoformans and C. albicans. In addition, some reports have shown that filamentation and pseudohyphal formation in C. glabrata is influenced under the effect of 5% CO2 atmosphere. Synthase of C. neoformans polysaccharide capsule was increased after exposure to 5% CO2 atmosphere. Also, changes were reported in C. albicans and C. glabrata which were drug-resistances due to exposure to 5% CO; expression of some virulence factors was also increased. Another study conducted by Yazdanparast and coworkers showed that certain conditions such as 10% CO2 in Trichophyton rubrum can cause the formation of arthroconidia from hyphal cells, so in some, dermatophytosis with this agent may trigger antifungal resistance [27]. Some studies have considered the general inhibitory effect of CO2 on fungal growth [28]. Some researches in 2004 announced that CO2 pressure could have detrimental effects on growth and metabolism of yeasts, such as inactivation of Saccharomyces cerevisiae cells. CO2 could change the C:N ratio and carbonic anhydrases (CAs) to affect the growth of fungal spores by protein production. Some reports indicated that some species of C. glabrata could produce pseudohyphal cells during nitrogen starvation. On other side, changes in CO2 pressure and oxygen can affect cell activity of S. cerevisiae which leads to cell inactivation [29].

Recent investigation demonstrates that C. glabrata had an ability to respond to CO2 pressure as a stimulus, and filamentation and pseudohyphal formation in C. glabrata under the effect of 5% CO2 atmosphere was seen [26]. Shimoda et al. showed CO2 pressure and temperature are applied for antimicrobial activity, also used for the preservation of foodstuffs by inactivation of cells such as Saccharomyces cerevisiae cells [30].

Another study has shown that MTBE and other ethers were used as a carbon source during the growth of propane by some microorganisms such as Mycobacterium spp. [31]. Peter Roslev and coworkers demonstrated the lack of androgenic response and weak estrogenic response in S. cerevisiae by exposing to MTBE [2].

Several species of Candida have infectious symptoms caused by their virulence factors, such as cell adhesion, biofilm formation, white-opaque (w-o), switching, and morphological transition that cause true and pseudohyphal forms in C. albicans. The importance of this commensal fungal reaction is due to resistance against antifungal drugs. Also, some main reasons for drug resistance are morphological transition and biofilm formation [32]. Treatments are often not possible, and many patients are unable to tolerate taking higher doses of antifungal drugs due to possible damages to some organs, including the liver and kidney. The Candida biofilm resistance phenomenon was for the first time established and demonstrated in 1995 for C. albicans by Hawser and Douglas. In Candida species knowledge of contribution of extracellular DNA to biofilm matrix and overall structure is scarce [33]. C. albicans biofilm matrix is composed of carbohydrate, protein, phosphorus, and hexosamine. Biofilm of C. glabrata consists of multilayers of blastospores with high connections among them and a high level of carbohydrate and protein [34]. The higher density of cells may be related to the high resistance of C. glabrata biofilm to antifungal azoles and amphotericin B [35], although some parameters such as PH, temperature, and oxygen availability are considered as inductors of biofilm architecture alternation and antifungal sensibility [36]. In 2014, Fonseca demonstrated the high level of proteins and carbohydrates in the matrix extract from biofilms in C. glabrata treated with fluconazole [35]. ERG11 is the most central point which increases the ergosterol production in C. glabrata cell membranes in response to azole. Probably during the early phase of biofilm growth efflux pumps in C. albicans and C. glabrata contribute to drug resistance [37].

Cell walls in C. glabrata have more mannoprotein that is linked to 1, 3β-glucan via 1,6-β glucan, and the largest group of mannoprotein is glycosylphosphatidylinositol (GPI). GPI-modified proteins are covalently bound to the wall by 1, 6-β glucan, which plays a key role in adhesion and biofilm formation. Cell wall protein and mannose/glucose ratio is higher in C. glabrata compared to C. albicans [6, 38]. Reducing drug resistance is considered the main goal of treatment for deep infection of candidiasis. In this study, we investigate the effect of a high concentration of CO2 (5%) and gasoline exhaust gases such as MTBE on C. albicans and C. glabrata isolates recovered from the patients.

Molecular proteins are produced by the aspartyl proteinase gene which has an important role in the virulence of Candida species. SAP expression is strain- and source-dependent and plays a significant and dramatic role in infections caused by Candida spp. [39]. SAPs are encoded by at least ten distinct highly regulated genes in a multigene family (SAP1 – SAP10). According to previous studies some members of this family are considered specific for some species of Candida, for instance, SAP 5-6 are exclusive to C. albicans but the lowest rate of proteinase production was found in C. glabrata and no specific SAP genes were detected in C. glabrata according to previous studies [40].

Recent studies indicated some pathogenic changes in C. glabrata and C. albicans in growth under CO2 atmosphere; they also reported molecular changes by adenylyl cyclase Cyr1 that promote white-to-opaque switching and then affect mating changes in C. albicans [25, 26]. Our results indicate that MICs of itraconazole and fluconazole against C. albicans and C. glabrata increased after confronting with some 5% CO2 pressure and 5mg/ml MTBE. However, the mechanism of resistance remained inconspicuous. We used these environmental factors to induce drug resistance in two species of Candida. The final MICs were relatively higher than the initial ones.

Shabir Ahmad Lone and coworkers in 2019 had claimed that the new antifungal eugenol tosylate congeners (ETC-5, ETC-6, and ETC-7) have a fungicidal effect on Candida spp. They have also shown the downregulation of the ERG11 gene which is related to ergosterol synthesis [41].

In the present study, expression of secretory enzymes including aspartyl protease (SAP) and biofilm formation and study of drug sensitivity modification (MIC) are evaluated by real-time PCR. We evaluated the effect of CO2 and MTBE on drug susceptibility and some virulence factors of C. glabrata and C. albicans isolates that were gained from clinical samples. The obtained results indicated that CO2 atmosphere and MTBE as two air pollution elements could enhance some virulence factors such as SAP1-3 in C. glabrata and C. albicans. These interferences could cause drug resistance in some species which were susceptible before confronted with CO2 or MTBE. Most of the mentioned changes were observed after 2–4 weeks of incubation under a 5% CO2 atmosphere or 5mg/ml MTBE.

In addition to molecular studies of the aforementioned genes, the function of other genes along with the epigenetic and genetic investigation of these genes in molecular pathways is important.

5
Conclusions

Some genes associated with C. albicans and C. glabrata virulence factors were increased by gaining resistance against antifungal drugs and due to confronting with air pollutants such as CO2 and MTBE.

Language: English
Page range: 243 - 253
Submitted on: Dec 9, 2020
Accepted on: Aug 19, 2021
Published on: Jun 29, 2022
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year

© 2022 Sahar Ghazanfari, Shahla Roudbar Mohammadi, Sassan Rezaie, Sadegh Khodavaisy, Ali Akbar Samadani, published by Hirszfeld Institute of Immunology and Experimental Therapy
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.