Have a personal or library account? Click to login
Increased transcript expression levels of DNA methyltransferases type 1 and 3A during cardiac muscle long-term cell culture Cover

Increased transcript expression levels of DNA methyltransferases type 1 and 3A during cardiac muscle long-term cell culture

Medical Journal of Cell Biology
Volume 9 (2021): Issue 1 (March 2021)
By: Mariusz J. Nawrocki,  Rut Bryl,  Sandra Kałużna,  Katarzyna Stefańska,  Bogumiła Stelmach,  Marek Jemielity,  Bartłomiej Perek,  Dorota Bukowska,  Paul Mozdziak,  James N. Petitte and  Bartosz Kempisty  
Open Access
|Mar 2021

Figures & Tables

Figure 1

RT-qPCR quantitative relative changes of analyzed DNMTs presented in a form of a bar graph. The graph shows the relative changes in gene expression results for 7, 15 and 30 days of cultivation, in relation to the transcript levels obtained from beginningo of our culture (0d). FC was presented in its logarithmic form to provide clear comparability of the results
RT-qPCR quantitative relative changes of analyzed DNMTs presented in a form of a bar graph. The graph shows the relative changes in gene expression results for 7, 15 and 30 days of cultivation, in relation to the transcript levels obtained from beginningo of our culture (0d). FC was presented in its logarithmic form to provide clear comparability of the results

Figure 2

Comparision of ΔCT values for analyzed DNMTs mRNA levels in different stages of culture. All calculations were made in relation to the expression levels for the individual genes at the time of beginning of the culture
Comparision of ΔCT values for analyzed DNMTs mRNA levels in different stages of culture. All calculations were made in relation to the expression levels for the individual genes at the time of beginning of the culture

Oligonucleotide sequences of primers used for RT-qPCR analysis

GENEPRIMER SEQUENCE (5′–3′)PRODUCT SIZE (BP)
DNMT1FGTGAGGACATGCAGCTTTCA211
RAACTTGTTGTCCTCCGTTGG
DNMT3AFCTGAGAAGCCCAAGGTCAAG238
RCAGCAGATGGTGCAGTAGGA
DNMT3BFACAGGTCGGCTCTTCTTTGA245
RAAAGCCCCTCGTTACCTGTT
DOI: https://doi.org/10.2478/acb-2021-0005 | Journal eISSN: 2544-3577
Journal RSS Feed
Language: English
Page range: 27 - 32
Submitted on: Feb 5, 2021
Accepted on: Mar 3, 2021
Published on: Mar 30, 2021
Published by: Foundation for Cell Biology and Molecular Biology
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year
Keywords:
epigenetics,
DNMTs,
cardiac muscle,
RT-qPCR
Related subjects:
Life sciences,
Molecular biology,
Biochemistry

© 2021 Mariusz J. Nawrocki, Rut Bryl, Sandra Kałużna, Katarzyna Stefańska, Bogumiła Stelmach, Marek Jemielity, Bartłomiej Perek, Dorota Bukowska, Paul Mozdziak, James N. Petitte, Bartosz Kempisty, published by Foundation for Cell Biology and Molecular Biology
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Previous articleVolume 9 (2021): Issue 1 (March 2021)Next article