Skip to main content
Have a personal or library account? Click to login
Histone demethylases JHDM1D, PHF2 and PHF8 expression pattern in granulosa cells obtained from patients undergoing IVF procedure during short-term IVC Cover

Histone demethylases JHDM1D, PHF2 and PHF8 expression pattern in granulosa cells obtained from patients undergoing IVF procedure during short-term IVC

Open Access
|Mar 2021

Full Article

Introduction

Granulosa cells (GCs) among the ovarian surface epithelium and the theca cells are one of three somatic cell types involved in folliculogenesis regulation. They accompany the oocyte during the last phase of preovulatory follicle growth, residing within the ovarian follicle's avascular space [1,2]. Mural GCs are involved in estrogen production in follicular phase and progesterone production after ovulation [3]. They play an important role in bidirectional communication with the oocyte regulating its growth, development and function [4,5].

It has been numerously reported that GCs cultured in vitro display stem-like potential and may be capable of differentiation into specialized cell types such as chondrocytes, neurons, muscle cells, cardiomyocytes and osteoblasts under appropriate conditions [6,7,8,9]. These unique properties, together with ease of collection during routine assisted reproductive technology procedures, make granulosa cells an attractive source of stem cells for applications in reconstructive and regenerative medicine. Furthermore, as adult cells, they are devoid of limitations specific to embryonic stem cells such as risk of teratoma formation, immune rejection and ethical controversies [10,11].

Epigenetics is a discipline which aims at studying heritable gene expression changes independent of DNA sequence but are rather influenced by DNA methylation, chromatin modification and non-coding RNAs[12,13]. JHDM1D (also known as KIAA1718 or KDM7A), PHF2, and PHF8 belong to a Jumonji C domain-containing (JmjC) family of proteins and can remove the methylation of H3K9, H3K27 and H4K20. Therefore, this 3 histone demethylases serve as transcription coactivators [14,15,16].

The establishment and molecular characterization of in vitro human granulosa cell culture may be of great importance for the future regenerative medicine applications, such as design of engineered tissue grafts or cell-based therapies for the treatment of female infertility [17].

The aim of this study was to characterize the expression levels of three genes encoding histone demethylases in short term in vitro cell culture of human granulosa cells in six time points: 48 h, 72 h, 96 h, 120 h, 144 h, 168 h in reference to 24 h by utilization of RT-qPCR technique.

Material and Methods
Patients and collection of GCs

Granulosa cells were obtained from patients undergoing in vitro fertilization (IVF) who had given their informed consent to be involved in the research. The study group included 14 patients, aged 18–40 years. Individuals with risk of inadequate ovarian stimulation were excluded from the study, according to Bologna's criteria of poor ovarian responders published by the European Society of Human Reproduction and Embryology (ESHRE) (serum antimullerian hormone (AMH) level of 0.7 ng/mL was used as a cut-off value) [18]. Patients with polycystic ovary syndrome (PCOS), endometriosis, who displayed day 2–3 FSH serum level higher than 15 mU/mL, and/or antral follicle count less than 9 were also excluded. IVF procedures were carried out in the Department of Infertility and Reproductive Endocrinology, Poznan University of Medical Sciences, Poznan. Patients diagnosed with infertility where subjected to proceedings based on controlled ovarian hyperstimulation protocol. Recombinant FSH (Gonal-F, Merck Serono, Darmstadt, Germany) and highly purified human menopausal gonadotropin (hMG-HP, Menopur, Ferring, Saint-Prex, Switzerland) were applied in order to stimulate ovarian response. For suppression of pituitary function, Cetrorelix Acetate (Cetrotide, Merck Serono, Darmstadt, Germany) injections in an adequate dose were administered. Subsequently, 6500 U of human chorionic gonadotropin (hCG; Ovitrelle, Merck-Serono, Darmstadt, Germany) was injected subcutaneously to induce ovulation. After transvaginal, ultrasound-guided oocyte pick-up (OPU), the follicular fluid (FF) containing GCs from ovarian follicles larger than 16 mm was collected for the analysis.

For GCs separation and collection, FF samples were centrifuged at 250 x g for 10 min.

Cell isolation and primary cell culture

After first centrifugation, the supernatant was discarded and the pellet was resuspended in 5 ml of Dulbecco's phosphate buffered saline (D-PBS; Sigma, St Louis, MO, USA). For cell separation, 15 ml falcon centrifuge tubes were filled with 6 ml of Pancoll (PAN Biotech, Aidenbach, Germany) and the layer of the separating solution was covered with the layer of the tested sample. Next, the samples were centrifuged at 390 rcf for 20 minutes and, afterwards, the top layer was transferred to a new 15 ml tube and resuspended in 5ml of culture medium consisting of: Dulbecco's Modified Eagle's Medium (DMEM; Sigma; Merck KGaA, Darmstadt, Germany), 10% fetal bovine serum FBS (FBS; Sigma; Merck KGaA, Darmstadt, Germany), 200 mM L-glutamine, 10 mg/ml gentamicin 10,000 units/ml penicillin, and 10,000 μg/ml streptomycin (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Subsequently, the centrifugation at 250 rcf for 10 minutes was performed, the pellet was suspended in 5ml of the culture medium and the samples were centrifuged at 250 x g for 5 minutes. The pellet was resuspended in 5 ml of collagenase type II (Sigma Aldrich, St. Louis, MO, USA) solution in Dulbecco's modified Eagle's medium (c = 1 mg/ml) and incubated at 37 °C for 10 minutes with gentle shaking. The obtained cell suspension was filtered through a cell strainer and transferred to a new 15 ml falcon centrifuge tubes. The samples were subjected to centrifugation at 250 x g for 10 minutes, the pellet was resuspended in 4 ml of culture medium and the suspension was transferred to 25 bottle. The cell culture was maintained at 37°C in a humified atmosphere of 5% CO2.

RNA Extraction

Total RNA was extracted after 24 h, 48 h, 72 h, 96 h, 120 h, 144 h and 172 h of the cell culture, respectively. Firstly, the cells were washed with D-PBS, digested with 0.05% trypsinethylenediaminetetraacetic acid (trypsin – EDTA; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) at 37°C for 1–2 minutes, neutralized by culture medium and centrifuged at 200 rcf for 5 minutes. The pellet was resuspended in 500 μl of TRI Reagent Solution (TRI Reagent®, Sigma-Aldrich, St. Luis, MO, USA). The aliquots were stored in −80°C until RNA isolation.

RNA Isolation

Total RNA was isolated according to the Chomczyński and Sacchi method [19]. Firstly, 150 μl of chloroform was added, the samples were mixed by inversion and shaken for 15 sec and then incubated for 10 min at RT. Subsequently, the biphasic emulsion was separated by centrifugation at 12 500 rpm for 15 min at 4°C. The aqueous phase which contained RNA was transferred to new Eppendorf tubes. Next, the isopropanol (Sigma-Aldrich, St. Luis, MO, USA, catalogue number I9516) was added (the volume was calculated according to the guidelines in the protocol: 250 μl of isopropanol was added to 400 μl of aqueous phase), the samples were mixed by inversion and shaken for 15 seconds and incubated for 15 minutes at RT. The samples were centrifuged at 12 500 rpm for 8 minutes at 4°C. 75% ethanol solution was added to the precipitate, the samples were vortexed, centrifuged at 7500 x g for 15 min at 4°C. The supernatant was discarded, the samples were air-dried and dissolved in 13 μl of PCR-grade water.

The spectrophotometric analysis at λ=260nm was performed (NanoDrop spectrophotometer; Thermo Fisher Scientific, Waltham, MA, USA) in order to assess the concentration and quality of the samples.

RT-qPCR (reverse transcription - quantitative polymerase chain reaction)
Reverse transcription

500 ng of isolated RNA from each sample was reverse transcribed by Transcriptor High Fidelity cDNA Synthesis Kit (Roche Diagnostics GmbH, Mannheim, Germany) according to the protocol. As to the priming method, both anchored oligo(dT)18 and random hexamer primers were used.

qPCR (quantitative polymerase chain reaction)

2 technical and 2 biological replicates for each time point of the culture were used. qPCRs were performed on Light Cycler 480 Instrument II (Roche Diagnostics GmbH, Mannheim, Germany).

cDNA synthesized in reverse transcription served as a template. The components of the reaction mix were as follows: QUANTUM Eva Green PCR Kit (Syngen Biotech, Wroclaw, Poland) which was used as the master mix, the 10 μM oligodeoxynucleotides which were purchased from Thermo Fisher Scientific (Thermo Fisher Scientific, Waltham, MA, USA) and are characterized in the table below (Tab. 1) and PCR-grade water. 9 μl of the reaction mix and 1 μl of the template were added to each, respective well on a 96-well plate. (LightCycler® 480 Multiwell Plates 96, Roche Diagnostics GmbH, Mannheim, Germany). The plate was sealed with a sealing foil (Light-Cycler® 480 Sealing Foil, Roche Diagnostics GmbH, Mannheim, Germany) centrifuged at 1500 rpm for 1 minute and placed in the thermocycler. The thermal profile of the reaction is presented in the table 2.

Table 1

Oligodeoxynucleotides designed to detect the expression levels of the studied genes

GENE NAME5′ → 3′ SEQUENCE OF THE FORWARD PRIMER5′ → 3′ SEQUENCE OF THE FORWARD PRIMERPRODUCT SIZE (BP)
JHDM1DTCCCTTCACCTACATTTTCTGTGCCTGCCTCGCCACATC89
PHF2CCATCGGTGCCAAGACAGGGGGGAGGTGGTGTTAGGAG164
PHF8CCCTCGCCATCATTCACTGTTCTCCCTCTTCCCGCTGT146
Table 2

Thermal profile of RT-qPCRs

STEPTEMPERATURE [°C]TIME [MIN]NUMBER OF CYCLES
Preincubation956001
AmplificationDenaturation951540
Annealing5815
Elongation7215
Melting95601
4060
701
951
Cooling37301

The 2−ΔΔCT method for relative gene expression analysis was applied [20]. cDNA synthesized from RNA isolated after 24h of cell culture served as a control. The relative expression of the studied genes was normalized against the expression of two reference genes – GAPDH and ACTB.

The analyses and graphs were performed and prepared using R language and environment and Microsoft Excel (Microsoft Corporation) [21].

Ethical approval

The research related to human use has been complied with all the relevant national regulations, institutional policies and in accordance the tenets of the Helsinki Declaration, and has been approved by the Poznan University of Medical Sciences Bioethical Committee with the resolution no. 558/17.

Informed consent statement

Informed consent has been obtained from all individuals included in this study.

Results

In this study, relative normalized gene expression of three genes encoding histone demethylases, namely JHDM1D, PHF2 and PHF8, at six time points of the cell culture: after 48 h, 72 h, 96 h, 120 h, 144 h and 168 h in reference to 24 h was assessed.

It was observed that the expression levels of PHF2 was elevated in all time points of the culture, while the tendency of JHDM1D and PHF8 was mainly a decrease in expression.

The lowest expression was reported for JHDM1D at 120 h of culture duration (log(2)FC of −2.78). With the exception of 72 h, JHDM1D displayed a decrease in expression.

PHF8 also exhibited a decrease of expression level mainly but not as large as for JHDM1D. However, for cell culture after 96h the expression level was close to control and for 72 h of culture duration was as follows: log(2)FC=0.17.

As described above PHF2 was the only gene for which the increase in expression was observed during all the time points of the culture, reaching log(2)FC of 3.13 for 120 h of culture.

Discussion

Granulosa cells play crucial role in folliculogenesis. Besides hormonal secretory function, they participate in bidirectional communication with oocytes via connexins which form gap junctions and via paracrine signaling. In this cross-talk, the GCs are involved in the regulation of growth, development and transcriptional activity in the female gamete [22,23,24].

The stem cell research has evolved greatly in the last 50–60 years and the interest in studying cell populations with stem-like properties is growing increasingly. It has been reported that GCs may display stemness and transdifferentiation potential, as they express molecular markers characteristic of stem cells: transcription factors such as OCT-4, NANOG and SOX-2, as well as MSC-specific cell surface markers, namely CD29, CD44, CD90, CD105, CD117, CD166 [6,17]. Furthermore, granulosa cells demonstrate high telomerase activity and have been shown to differentiate into i.e. neurogenic, chondrogenic and osteogenic lineages [6,25].

Figure 1

Relative normalized expression of JHDM1D, PHF2 and PHF8 in six time points of the human granulosa cell culture (48h, 72h, 96h, 120h, 144h and 168h). The values are presented as logarithm to the base 2 of the fold change (log(2) FC) of the tested culture duration vs. 24 h culture duration

The establishment and determination of genetic and epigenetic changes in granulosa cells during cell culture is necessary for the future applications in fields such as organ reconstruction, tissue engineering as well as in cell-based therapy of female infertility [17].

Epigenetics is the study of heritable gene expression changes independent of DNA sequence [12,13]. Together with DNA methylation and miRNAs, histone modifications constitute one of the most studied hallmarks of epigenetic inheritance [26]. The N-terminal tails of the histones may undergo post-translational modifications (PTMs), which impact various molecular processes such as transcription, replication, and chromosome maintenance [27].

In this study, changes of transcript levels of genes JHDM1D, PHF2 and PHF8 which may affect the state of posttranslational modifications of histones were assessed.

Histone methylation is a key covalent histone modification in epigenetic regulation and occurs at lysine and arginine residues at histone tails [28]. It is implicated in both transcriptional activation and repression depending on position and methylation state. H3K4, H3K36 and H3K79 methylations confer active transcription, while H3K9, H3K27 and H4K20 methylations are considered to mark silenced chromatin states. There are three lysine methylation states—mono-, di- and trimethylation [29]. As to maintain proper cell fate and genomic stability, two classes of enzymes regulate the methylation of amino acid residues within histones: methyltransferases (KMTs) and demethylases (KDMs) [27].

Jumonji C domain containing histone demethylase 1 homolog D (JHDM1D, also known as KIAA1718 or KDM7A) is a member of the plant homeodomain (PHD) finger protein (PHF) family and thus possesses a single N-terminal plant homeodomain (PHD) which participates in epigenetic regulation [30]. The Jumonji C domain is responsible for removal of the dimethylation of histone H3 lysine 9 and lysine 27 (H3K9me2 and H3K27me2, respectively), while PHD domain binds H3K4me3 and controls the rate of demethylation [31]. It has been reported that JHDM1D plays a tumor suppressive role by regulation of angiogenesis, may regulate neural differentiation and development in mammals and is upregulated during cardiomyocyte differentiation of mouse embryonic stem cells [31,32,33]. Furthermore, decreased expression of JHDM1D was found to be associated with preeclampsia through down-regulating HLA-G [14].

Histone demethylase plant homeodomain finger 2 (PHF2) is a dimethylated histone H3 lysine 9 (H3K9me2) demethylase that also recognizes histone trimethyl H3K4 (H3K4me3) through its PHD. It is described as a transcriptional activator [15]. It was demonstrated that PHF2 can demethylate H4K20me3 and is suggested to act on non-histone targets [34,35]. PHF2 displays high expression in embryonic neural tube and ganglia [36]. It is implicated in control of proinflammatory genes and act as a tumor suppressor through epigenetic regulation of p53 [37,38]. Recently, PHF2 was shown to promote DNA repair by homologous recombination by controlling CtIP-dependent resection of double strand breaks [15].

PHF8 demethylates monomethyl H4K20 (H4K20me1) with additional demethylase activities of H3K9me1 and H3K9me2. PHF8 can regulate neural development, and various mutations in PHF8 can lead to X-linked mental retardation, intellectual disability, autism and cleft lip/palate [16,39]. As reported by, this histone demethylase can bind more than one third of genes, nevertheless physiologically regulates only 2–5% of these targets [40]. Moreover, it has been demonstrated that PHF8 is involved in regulation of the G0/G1-to-S transition through interaction with E2F1, promote epithelial-to-mesenchymal transition and has also been reported to interact with MYC to regulate cytoskeletal dynamics in HeLa cells [16,41,42].

Although there are no studies reporting expression pattern or functional implication of this particular enzymes in human granulosa cells to date, several reports demonstrate granulosa cell-specific expression and possible implications of epigenetic-modifying enzymes in regulation of follicullogenesis. A study by Krieg et al. aimed at the assessment of expression of two histone demethylases, namely KDM4A and KDM4B, in granulosa cells from patients undergoing in vitro fertilization. It was demonstrated that this two genes were differentially expressed in both cumulus and mural granulosa cells and a relation between pregnancy outcome and expression of both KDM4A and KDM4B mRNA in cumulus granulosa and mural cells was reported [43]. In another study, cell-specific and developmentally regulated patterns of histone H3 methylation at lysine 4 (K4) in porcine preovulatory follicles and during luteinization in pig ovaries were determined. It was demonstrated that H3K4 methylation in GCs was distribution and follicular stage-specific. Expression of lysine-specific demethylase 1 (LSD1 or KDM1) was corpus luteum-restricted [44]. Moreover, Guo et al. observed a cell-specific large-magnitude decrease in histone demethylase KDM1A in granulosa cells from ovaries of prenatal testosterone (T)-treated sheep and corresponding large-magnitude increase in SUV39H1, which is a histone methyltransferase [45].

In the present study we examined the expression levels of JHDM1D, PHF2 and PHF8 and observed their respective: tendency for downregulation with the exception of the time point of 72 h (JHDM1D), stating the repression of transcription, global, although not gradual upregulation (PHF2), which would suggest a transcriptional activation of targeted genes and downregulation trend with the exception of 72 h and 96 h time point (PHF8) which implies a situation similar as observed for JHDM1D. These results may point towards dynamic epigenetic changes in human granulosa cells during short-term IVC.

Conclusions

In this study, an insight into the transcriptomic changes in human GCs during in vitro cultivation was provided. A tendency for decrease in expression of JHDM1D and PHF8 suggests repression of transcription, while the observed increase in PHF2 expression is associated with transcriptional activation of target genes. Further study on a larger population with the aim of target genes identification would be required in order to confirm and broaden the scope of the presented results.

Language: English
Page range: 1 - 7
Submitted on: Jan 4, 2021
Accepted on: Jan 29, 2021
Published on: Mar 30, 2021
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2021 Rut Bryl, Katarzyna Stefańska, Błażej Chermuła, Bogumiła Stelmach, Wojciech Pieńkowski, Jakub Kulus, Joanna Perek, Maria Wieczorkiewicz, Grzegorz Wąsiatycz, Kornel Ratajczak, Leszek Pawelczyk, Paul Mozdziak, Michal Jeseta, Robert Z. Spaczyński, Dorota Bukowska, published by Foundation for Cell Biology and Molecular Biology
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.