Recombinant phospholipase A2 inhibitor of Sinonatrix annularis (ringed water snake) attenuates hemorrhagic action of the venom from Daboia siamensis (Siamese Russell’s viper)

The S. annularis PLIϒ gene, a partial sequence without signal peptides (553 bp, JN975878, GenBank) from the snake liver, was processed into the pET-24a vector by Synbio Technologies. As such, Escherichia coli (E. coli) BL21 (DE3) cells, the bacterium with compatibility with pET24a expression allow isopropyl β-D-1-thiogalactopyranoside (IPTG) to release the Lac repressor and initiate RNA polymerase binding to the promoter for gene transcription, were transformed with pET24a-PLIϒ of S. annularis by heat shock on Luria Bertani (LB) medium containing 50 μg kanamycin agar plate at 37°C. Notably, the pET-24a (+) vector is a popular plasmid vector used for recombinant protein expression in E. coli with a strong T7 promoter allowing high expression of target proteins, Lac operon control for inducing the expression with IPTG, and a simple 6x polyhistidine-tag (His-Tag) for protein purification. Each colony that grew on a kanamycin agar plate was picked by needle tip, transferred to a polymerase chain reaction (PCR) reagent tube for PLIϒ gene amplification, and confirmed as a positive colony by PCR. Forward primer: TAATACGACTCACTATAGGG, reverse primer: GCTAGTTATTGCTCAGCGG, and TaKaRa Taq DNA polymerase (Takara Bio Inc.) were used in the PCR. The PCR conditions were 5 min at 94 °C, 35 cycles of 3 min at 94 °C, 30 sec at 55 °C, and 30 sec at 72 °C, followed by an extension period of 7 min at 72 °C (Perkin Elmer). The obtained PCR product size of around 500 bp would confirm a positive clone colony. The positive colony was incubated in 50 mL of LB broth containing 50 μg kanamycin and shaken at 37 °C, overnight. Then, 10 mL of cell culture was transferred into 1 L of LB containing 50 μg kanamycin. The cells were grown at 37 °C with shaking at 160 rpm. When the optical density (OD) at 600 nm reached 0.4-0.6, IPTG was added to the culture to a final concentration of 1 mM and shaken at 37 °C, overnight. After that, PLIϒ expression was detected by 1 mL of the cell suspension to run 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). One liter of cultivated recombinant BL21 (DE3) cells was washed with phosphate-buffered saline (PBS) buffer, pH 7.4. The recombinant bacteria were resuspended in 20 mL PBS buffer, pH 7.4, and rested on ice for 20 min. The cells were sonicated on an ice bath with a program of 10 s sonication and stopped by 2 min intervals of resting for 4 rounds. After centrifugation of the lysate at 6,000 rpm for 10 min, the pelleted cell (part of the inclusion bodies) was collected. The pelleted cell was dissolved in 8 M urea, 20 mM Na₂HPO₄, and 0.5 M NaCl, pH 7.4, and gently agitated with a magnetic bar at 4 °C overnight. The undissolved particles were removed by centrifugation, and the protein concentration of the supernatant was determined by Qubit Protein Assay Kits, Thermo Fisher. The PLIϒ was purified by an ÄKTA pure machine (GE) based on the His-tag method that typically consists of at least 6 histidine (His) residues at the N- or C-terminus of the protein. The supernatant was loaded onto a 1 mL HisTrap FF column (Cytiva), which was pre-equilibrated with 5-fold column volumes (CV) of binding buffer (8 M urea, 20 mM Na₂HPO₄, and 0.5 M NaCl, pH 7.4). The column was continually washed with binding buffer to baseline, then washed with a urea gradient for refolding from 8 M to 0 M urea by creating a stepwise gradient from 100% of urea to 0% of urea solution (20 CV, 20 mL) with a solution containing 8 M urea, 20 mM NaH₂PO₄, 20 mM, 0.5 M NaCl, pH 7.4, and 20 mM NaH₂PO₄, 20 mM, 0.5 M NaCl, pH 7.4. Finally, the column was washed by a stepwise gradient of elution buffer 10% elution buffer containing 500 imidazole, 20 mM NaH₂PO₄, 20 mM, 0.5 M NaCl, pH 7.4 to elute histidine-tag PLIϒ (His6-PLIϒ). After that, PLIϒ was dialyzed with 0.98% normal saline, and protein concentration was measured using Qubit Protein Assay Kits (Thermo Fisher Scientific).

The protein solution was digested using 12.5 μg/mL of sequencing-grade trypsin (Promega) and incubated at 37 °C for approximately 16 h. The supernatants were then transferred to a new tube, and 100 μL of 50% acetonitrile (ACN)/0.5% formic acid was added. The mixtures were finally dried with a speed vac, and the resulting peptides were suspended in 10 μL of 50% ACN/0.1% formic acid. The peptides were then analyzed by liquid chromatography-mass spectrometer (LC-MS/MS; TripleTOF 6600+, Sciex) at Mahidol University (Frontier Research Facility), Bangkok, Thailand. Protein identification was performed using the search engine named PEAKS (Version: PEAKS Studio 10.6 build 20201221).

The assay was performed following a previous publication [17]. Briefly, the crude venoms (powdered) of D. siamensis, Trimeresurus albolabris (T. albolabris), Calloselasma rhodostoma (C. rhodostoma), Naja kaouthia (N. kaouthia), and Ophiophagus hannah (O. hannah) were obtained from the snake farm (Queen Saovabha Memorial Institute, Bangkok), and 25 μL of 0.5 mg/mL of crude snake venom in PBS, pH 7.4, was added to 500 μL of 10 mM Tris-HCl, 10 mM CaCl2, and 0.1 M NaCl, pH 8.0, on ice. Then, 50 μL of 4-nitro-3-octanoyloxy benzoic acid (Abcam), a chromogenic substrate for PLA₂, was added and incubated at 37 °C for 20 min before stopping the reaction by 50 μL of stopper buffer (2.5% Triton X-100) on ice for 5 s. The reaction tubes were left at room temperature for 5–10 min and measured for OD at 425 nm by a spectrophotometer (Beckman, Brea). The specific activity of PLA₂ is defined as a change in absorbance of 0.1 AU at 425 nm, equivalent to 25.8 nanomoles of released chromophore. To explore the neutralization property of PLIϒ, 25 μL of purified PLIϒ in concentrations of 10 μg, 20 μg, 30 μg, 40 μg, and 50 μg were independently added into the crude D. siamensis (25 μL of 0.5 mg/mL) and incubated at room temperature for 30 min before testing PLA₂ activity using the protocol mentioned earlier.

The study protocol was approved by the Institutional Animal Care and Use Committee of the Queen Saovabha Memorial Institute, Bangkok, Thailand (Certificate of approval no. QSMI-ACUC-06-2025), following the National Institutes of Health (NIH), USA. Male MLAC/ICR mice (Institute of Cancer Research strain), obtained from the Microbiological and Laboratory Animal Center (MLAC), 8 weeks of age, weighing 20 ±5 g from Nomura Siam International Co., Ltd. (Lumphini, Pathumwan, Bangkok, Thailand) were used. Notably, only male mice were used to reduce the gender variability in the proof of concept experiments, and the impacts on female mice need further testing. All experiments were performed in a standard facility of rodent housing with a temperature-controlled environment (24 ± 2 °C), 50% relative humidity, a 12 h light-dark cycle (light from 7:00 a.m. to 7:00 p.m.), and a standard diet and water. To test the MHD of D. siamensis venom, the hemorrhagic assay, following a previous description [18], was performed. Briefly, crude D. siamensis venom in 50 μL PBS was intradermally injected (ID) in mice with 0 μg, 4 μg, 8 μg, 12 μg, and 16 μg (n = 5/dose). The mice with PBS alone (0 μg of venom) were used as a negative control. After 3 h, mice were euthanized using CO₂, and the dorsal patch of skin was removed to observe for hemorrhagic lesions on the inner surface of the skin (measured by cross-diameter hemorrhagic spots).

The diameter of the hemorrhagic spot on the inner surface of the mouse skin was measured to determine the MHD, defined as the venom dose that produces a 10-mm hemorrhagic lesion. To test against the hemorrhagic activity of D. siamensis, PLIϒ (10 μg in 25 μL) was mixed with 25 μL of 16 μg of crude D. siamensis venom and incubated at room temperature for 30 min before using this mixed solution (50 μL) to ID into the mice (n = 5). The group of mice that received PLIϒ alone was used as a negative control (n = 3). After 3 h, the mice were euthanized using CO₂ and the dorsal patch of the skin was removed and observed for hemorrhage on the inner surface of the skin as mentioned above. The spot (mm) of the hemorrhagic area on the inner surface of the skin was measured as the representative hemorrhagic activity.

Data presented by mean standard error (SE) and tested by 1-way analysis of variance followed by Bonferroni’s multiple comparisons tests using PRIMER of Biostatistics software analysis. The differences were considered significant at P < 0.05.

The PLIϒ gene was inserted into the pET-24a vector and cultured (see method). The expression of PLIϒ protein (Figure 1A), the chromatogram of purification (Figure 1B), and purified PLIϒ were demonstrated on the SDS-PAGE (Figure 1C) and confirmed by mass spectrometry (Figure 1D).

Figure 1.

The representative picture of SDS-PAGE indicated the expression of PLIϒ proteins in the soluble (left side) and inclusion forms (right side) (A) was demonstrated. The chromatogram of PLIϒ after the purification by the HisTrap FF column (B) and the PLIϒ protein isolated from the column (the magnified peak with the red-colored alphabets in B) was tested for the purification as indicated in SDS-PAGE (C). The amino acid sequence of isolated PLIϒ, as performed by LC–MS/MS, was also shown (D). LC–MS/MS, liquid chromatography-mass spectrometry; PLIϒ, phospholipase A₂ inhibitor gamma form; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis.

The PLIϒ gene was inserted into the pET-24a vector, and the cell culture was activated by IPTG, the inducer of protein expression. Then, the cells were harvested, disrupted by sonication, and processed on the SDS-PAGE to detect PLIϒ in the soluble or inclusion forms. There were highly expressed PLIϒ proteins in the inclusion bodies with the smeared band between 15 kDa and 25 kDa (Figure 1A).

Notably, protein expressions in inclusion bodies could be found in recombinant proteins through the accumulation of misfolded proteins in the cytoplasm or periplasm of the host cells, and the refolding of the proteins is naturally possible [19]. Then, a chaotropic agent (8 M urea) was used to recover and refold PLIϒ protein from inclusion bodies to its natural form during purification (see method). As such, PLIϒ in 8 M urea was loaded into a HisTrap FF column (1 mL) and was refolded by a stepwise gradient. In the refolding step (16–40 mL), the urea concentration gradually reduced from 8 M to 0 M (no urea buffer in the column) without noise protein (no detected UV 280 signal), which process was under the green line area. The percentage of gradient urea from 100 to 0 in the green line was related to graph axis 3 on the right (Figure 1B). After the folding step, the PLIϒ peak gradually appeared at mL of 42–45 with a stepwise gradient of 10% of imidazole elute buffer. After finishing PLIϒ purification, a chromatogram was performed on only the single peak (blue-colored peak), representing the purified PLIϒ (redcolored alphabet) without other contaminated protein peaks (Figure 1B). The high protein peak at the front part of the chromatogram (at mL 0–10) was the unbinding proteins to the HisTrap FF column. Then, the purification was performed using a ready-to-use column, prepacked with the pre-charged Ni Sepharose 6 Fast Flow for preparative purification of His-tag recombinant proteins by immobilized metal ion affinity chromatography (see method). As such, PLIϒ obtained from the single peak showed a single protein band at approximately 20 kDa on SDS-PAGE (Figure 1C). Before purification, the dissolved pellet cell (from 1 L of culture) in 8 M urea had a concentration of 4.44 mg/mL. Then, after the purification by an ÄKTA pure machine (GE), the PLIϒ protein concentration was 187.20 μg/mL (4% of total protein).

Five snake venoms, including D. siamensis, C. rhodostoma, N. kaouthia, T. albolabris, and O. hannah, were screened for PLA₂ activity (Figure 2A) and tested by the recombinant PLIϒ from the previous experiments (Figure 2B). As such, the highest PLA₂ activity was presented in D. siamensis (Siamese Russell’s viper), and the lowest level was in O. hannah (king cobra) (Figure 2A). Due to the highest PLA₂ activity in crude D. siamensis venom, the PLA₂ inhibitory activity of PLIϒ was tested in D. siamensis venom as a representative experiment. As such, PLIϒ at several concentrations (10–50 μg) similarly attenuated PLA₂ activity (Figure 2B). To test the activity in vivo, mice were injected intradermally with different doses (0–16 μg) of crude venom from D. siamensis to determine the emergence of MHD in the diameter (mm) of the inner skin of mice. As such, the intradermal injection of crude venom from D. siamensis at the dose of 16 μg demonstrated the most severe lesion at 3 h post-injection compared to other doses, as indicated by the diameter of hemorrhagic spots on the inner side of the mouse’s skin (Figure 3A). Despite the severe hemorrhage caused by 16 μg D. siamensis venom, mixing PLIϒ (10 μg) into the venom before injection induced less severe hemorrhage, as indicated by lower MHD values (Figures 3B, C), suggesting the neutralizing effect of PLIϒ. Notably, only PLIϒ at 10 μg was used in Figure 3 due to the non-dosedependent effect among 10–50 μg in Figure 2B. Our data demonstrated a proof-of-concept to use PLIϒ against D. siamensis venom; the impacts of PLIϒ against other snake venoms will be interesting.

Figure 2.

The screening PLA₂ activity of venoms from several types of snakes (A) and the minus percent of the PLA₂ activity in D. siamensis venom (a representative venom) by PLIϒ (B) was demonstrated. Isolated triplicate experiments were performed. PLA₂, phospholipase A₂; PLIϒ, phospholipase A₂ inhibitor gamma form.

Figure 3.

Crude D. siamensis-induced hemorrhagic activities with MHD without or with PLIϒ (A, B) with the representative pictures of mouse skin (C) were demonstrated (n = 3–5/group). MHD, minimal hemorrhagic dose; PLIϒ, phospholipase A₂ inhibitor gamma form.