Table I
The sequence of oligonucleotide probes and hybridization conditions used in FISH procedure for the identification of the bacteria present in children faeces.
| Probe | Identified microorganisms | Sequence (5’→3’) | Fluorescent label | Temp [°C] | Time [h] |
|---|---|---|---|---|---|
| Lab 158 | Lactobacillus-Enterococcus | GGT ATT AGC A(T?C)CTGT TTC CA | 5’Fluo | 46 | 24 |
| Bif 164 | Bifidobacterium spp. | CAT CCG GCA TTA CCA CCC | 5’Cy3 | 58 | 18 |
| Bac 303 | Bacteroides-Prevotella | CCA ATG TGG GGG ACC TT | 5’Cy3 | 55 | 3 |
| Erec 484 | Clostridium coccoides | GCT TCT TAG TCA GGT ACC G | 5’Cy3 | 57 | 16 |
| Prov | Prevotella | ATCTTGAGTGAGTTCGATGTTGG | 5’Fluo | 57 | 18 |

Fig. 1.
The number of bacteria isolated from stool of overweight, obese and normal weight children

Fig. 2.
Contribution of the main types of bacteria isolated from the stool of obese children (a), normal weight children (b), and obese 3 children at > 95 percentile (c)
Table II
SCFAs and BCFAs in the stool of overweight, obese and normal weight children.
| Acid | Obese children | Children with normal weight | |||||
|---|---|---|---|---|---|---|---|
| Acid concentration [mg g–1 stool] | Average [mg g–1 stool] | Median [mg g–1 stool] | Acid concentration [mg g–1 stool] | Average [mg g–1 stool] | Median [mg g–1 stool] | p | |
| Lactic | 0.017–4.351 | 1.35 | 1.126 | 0.093–4.909 | 2.24 | 1.804 | 0.014 |
| Acetic | 0.111–1.289 | 0.71 | 0.650 | 0.026–3.269 | 1.38 | 1.122 | 0.279 |
| Propionic | 0.085–1.232 | 0.67 | 0.594 | 0.050–2.128 | 1.08 | 0.985 | 0.354 |
| Butyric | 0.014–0.543 | 0.40 | 0.381 | 0.030–0.948 | 0.33 | 0.299 | 0.446 |
| Formic | 0.008–0.660 | 0.20 | 0.199 | 0.010–0.484 | 0.21 | 0.154 | 0.645 |
| Valeric | 0.012–0.412 | 0.26 | 0.254 | 0.063–0.472 | 0.20 | 0.187 | 0.164 |
| Total SCFA | 0.342–7.521 | 3.59 | 2.708 | 0.424–10.18 | 5.44 | 3.974 | 0.040 |
| BCFA | |||||||
| Isobutyric | 0.048–0.341 | 0.16 | 0.100 | 0.020–0.545 | 0.23 | 0.200 | 0.640 |
| Isovalerian | 0.017–0.528 | 0.20 | 0.120 | 0.001–1.180 | 0.20 | 0.121 | 0.913 |
| Total BCFA | 0.022–0.896 | 0.36 | 0.255 | 0.001–1.151 | 0.44 | 0.421 | 0.741 |