Fig. 1.
Fig. 2.
The sequence of oligonucleotide probes and hybridization conditions used in FISH procedure for the identification of the bacteria present in children faeces_
| Probe | Identified microorganisms | Sequence (5’→3’) | Fluorescent label | Temp [°C] | Time [h] |
|---|---|---|---|---|---|
| Lab 158 | Lactobacillus-Enterococcus | GGT ATT AGC A(T?C)CTGT TTC CA | 5’Fluo | 46 | 24 |
| Bif 164 | Bifidobacterium spp. | CAT CCG GCA TTA CCA CCC | 5’Cy3 | 58 | 18 |
| Bac 303 | Bacteroides-Prevotella | CCA ATG TGG GGG ACC TT | 5’Cy3 | 55 | 3 |
| Erec 484 | Clostridium coccoides | GCT TCT TAG TCA GGT ACC G | 5’Cy3 | 57 | 16 |
| Prov | Prevotella | ATCTTGAGTGAGTTCGATGTTGG | 5’Fluo | 57 | 18 |
SCFAs and BCFAs in the stool of overweight, obese and normal weight children_
| Acid | Obese children | Children with normal weight | |||||
|---|---|---|---|---|---|---|---|
| Acid concentration [mg g–1 stool] | Average [mg g–1 stool] | Median [mg g–1 stool] | Acid concentration [mg g–1 stool] | Average [mg g–1 stool] | Median [mg g–1 stool] | p | |
| Lactic | 0.017–4.351 | 1.35 | 1.126 | 0.093–4.909 | 2.24 | 1.804 | 0.014 |
| Acetic | 0.111–1.289 | 0.71 | 0.650 | 0.026–3.269 | 1.38 | 1.122 | 0.279 |
| Propionic | 0.085–1.232 | 0.67 | 0.594 | 0.050–2.128 | 1.08 | 0.985 | 0.354 |
| Butyric | 0.014–0.543 | 0.40 | 0.381 | 0.030–0.948 | 0.33 | 0.299 | 0.446 |
| Formic | 0.008–0.660 | 0.20 | 0.199 | 0.010–0.484 | 0.21 | 0.154 | 0.645 |
| Valeric | 0.012–0.412 | 0.26 | 0.254 | 0.063–0.472 | 0.20 | 0.187 | 0.164 |
| Total SCFA | 0.342–7.521 | 3.59 | 2.708 | 0.424–10.18 | 5.44 | 3.974 | 0.040 |
| BCFA | |||||||
| Isobutyric | 0.048–0.341 | 0.16 | 0.100 | 0.020–0.545 | 0.23 | 0.200 | 0.640 |
| Isovalerian | 0.017–0.528 | 0.20 | 0.120 | 0.001–1.180 | 0.20 | 0.121 | 0.913 |
| Total BCFA | 0.022–0.896 | 0.36 | 0.255 | 0.001–1.151 | 0.44 | 0.421 | 0.741 |