Table I
Sequences of primers used in reaction of amplifications of the fragments of CEPs genes.
| Gen | Primer | Sequence (5’→3’) | Tm [°C] | Source |
|---|---|---|---|---|
| prtH | PrtH-for-1 PrtH-rev-1 | GGTACTTCAATGGCTTCTCC GATGCGCCATCAATCTTCTT | 51.8 49.7 | Genay et al., 2009; Lozo et al., 2011 |
| prtH2 | prtH2f prtH2r | AAGCAAAGGATGTTGTTCCAAGTAAGCCA CTCTCTTCCTTCTTACCAGTTGATGATTGAACT | 58.7 60.7 | Smeianov et al., 2007 |
| prtH3 | prtH3f prtH3r | GATGATCAAGCAGATGTAAAACCGGCAGAAG ATTTACTGAAGAATTAGTCAAATGACCTGTTGTCGG | 61.7 61.0 | Broadbent et al., 2011 |
| prtH4 | prtH4f prtH4r | CTGAAGCAGCAACTAATGATCCTGG TGGATTAGGATCCGTTCTGGTTGTCAG | 57.7 59.7 | Broadbent et al., 2011 |
Fig. 1.
Agarose gel electrophoresis of Multiplex PCR products obtained for Lactobacillus helvetisus strains: 1 – 80; 2 – T104; 3 – T105; 4 – T159; 5 – 14; 6 – B734; 7 – T103; 8 – T15; 9 – T199; 10 – T80; 11 – K1; 12 – DSMZ 20075; M – DNA molecular marker 100 bp.
Fig. 2.
Results of amplification genes encoding CEPs: prtH (A); prtH2 (B); prtH3 (C) in Lactobacillus helvetisus strains: Line: 1 – 80; 2 – T104; 3 – T105; 4 – T159; 5 – 141; 6 – B734; 7 – T103; 8 – T15; 9 – T199; 10 – T80; 11 – K1; 12 – DSMZ 20075; line 13: Lactobacillus rhamnosus E/N; M – DNA molecular marker.
Table II
The proteolytic activity of L. helveticus strains.
| The bacterial strain | Proteolytic activity [mM of released α-aminoacids/l] | Profiles of amplification products of CEPs |
|---|---|---|
| L. helveticus T104 | 87.06c ± 0.21 | I (prtH/prtH2/prtH3) |
| L. helveticus T105 | 114.72a ± 0.64 | |
| L. helveticus 141 | 57.67d ± 0.54 | |
| L. helveticus B734 | 58.78d ± 0.52 | II (prtH/prtH3) |
| L. helveticus 80 | 37.78h ± 0.68 | III (prtH2/prtH3) |
| L. helveticus T159 | 42.67e ± 0.14 | |
| L. helveticus T15 | 40.61fg ± 0.48 | |
| L. helveticus T199 | 40.61fg ± 0.34 | |
| L. helveticus DSMZ 20075 | 96.94b ± 1.1 | |
| L. helveticus T103 | 41.33ef ± 0.36 | IV (prtH3) |
| L. helveticus T80 | 39.78fg ± 0.28 | |
| L. helveticus K1 | 40.11fg ± 0.42 | |
| L. rhamnosus E/N | 39.11gh ± 0.44 | – |
Fig. 3.
Sequence alignment for prtH of chosen strains and Lactobac illus helveticus CRZN32 (no. AF133727). Stars indicate residues that are similar in all sequences.
Fig. 4.
Phylogenetic tree of prtH3 gene sequences of analyzed Polish L. helveticus strains and L. helveticus CNRZ32 (no. HQ602769.1).
Table III
Dynamics of decrease of skim milk pH value during fermentation conducted by L. helveticus strains.
| L. helveticus strain | ΔpH* | |||||
|---|---|---|---|---|---|---|
| 6 h | 12 h | 18 h | 24 h | 30 h | 36 h | |
| T104 | 1.31 ± 0.01 | 1.35 ± 0.01 | 0.48 ± 0.01 | 0.03 ± 0.01 | 0.08 ± 0.01 | 0 |
| T105 | 1.79 ± 0.01 | 1.23 ± 0.02 | 0.24 ± 0.02 | 0.05 ± 0.01 | 0.01 ± 0.01 | 0.01 ± 0.01 |
| 141 | 0.8 ± 0.01 | 0.62 ± 0.01 | 0.76 ± 0.01 | 0.07 ± 0.02 | 0.22 ± 0.01 | 0.13 ± 0.01 |
| B734 | 0.86 ± 0.02 | 0.24 ± 0.01 | 0.75 ± 0.01 | 0.06 ± 0.01 | 0.5 ± 0.02 | 0 |
| 80 | 0.8 ± 0.01 | 0.21 ± 0.01 | 0.78 ± 0.01 | 0.09 ± 0.01 | 0.49 ± 0.01 | 0.17 ± 0.01 |
| T159 | 0.90 ± 0.01 | 0.15 ± 0.03 | 0.65 ± 0.02 | 0.22 ± 0.02 | 0.53 ± 0.01 | 0.23 ± 0.01 |
| T15 | 0.74 ± 0.01 | 0.16 ± 0.02 | 1.05 ± 0.01 | 0.09 ± 0.01 | 0.51 ± 0.01 | 0 |
| T199 | 0.85 ± 0.01 | 0.23 ± 0.02 | 0.82 ± 0.01 | 0.04 ± 0.01 | 0.49 ± 0.01 | 0.28 ± 0.01 |
| DSMZ 20075 | 0.89 ± 0.02 | 0.66 ± 0.03 | 0.31 ± 0.01 | 0.66 ± 0.01 | 0.22 ± 0.01 | 0 |
| T103 | 0.76 ± 0.01 | 0.33 ± 0.02 | 1.06 ± 0.02 | 0.20 ± 0.01 | 0.25 ± 0.01 | 0 |
| T80 | 0.93 ± 0.01 | 0.89 ± 0.01 | 0.18 ± 0.01 | 0.54 ± 0.01 | 0.07 ± 0.01 | 0.21 ± 0.01 |
| K1 | 0.82 ± 0.03 | 0.24 ± 0.02 | 0.76 ± 0.01 | 0.14 ± 0.01 | 0.56 ± 0.03 | 0.26 ± 0.01 |