Have a personal or library account? Click to login
Transfer of Meloidogyne incognita Resistance Using Marker-assisted Selection in Sorghum Cover

Transfer of Meloidogyne incognita Resistance Using Marker-assisted Selection in Sorghum

Journal of Nematology
Volume 53 (2021): Issue 1 (January 2021)
By: Richard F. Davis,  Karen R. Harris-Shultz,  Joseph E. Knoll and  Hongliang Wang  
Open Access
|Nov 2021

Figures & Tables

Figure 1:

Polyacrylamide gel image of microsatellite marker RKNP135 from the sorghum donor line ‘Honey Drip’, the recurrent parents ‘Collier’, GT-IR7, ‘Dale’, and ‘Top 76-6’, and the BC1F6 progeny lines. A 50-350 bp sizing standard (LI-COR Biosciences, Lincoln, NE) was loaded in the first and last lanes.

Presence of the introgression from ‘Honey Drip’ in the QTL-Sb_RKN_3_1 region of each backcross (BC1F6) line_

Allele Sizes (bp)
RKNP17a RKNP135RKNP342RKNP402RKNP529
NC_012872 (bp)b(52,744,750)(53,190,542)(53,974,058)(54,199,591)(54,678,311)
Genotype
 Honey Drip 120, 120 153, 153 240, 240 173, 173 222, 222
 Entry 22198, 198210, 210222, 222204, 204185, 185
 Entry 22-BC1F6 120, 120 153, 153 240, 240 173, 173 222, 222
 Collier198, 198200, 200220, 220253, 253116, 116
 Collier-BC1F6 120, 120 153, 153 240, 240 173, 173 222, 222
 GT-IR7198, 245210, 210220, 220265, 265116, 232
 GT-IR7-BC1F6 120, 120 153, 153 240, 240 173, 173 222 , 232
 Dale198, 198206, 206222, 222234, 234185, 185
 Dale-BC1F6 120, 120 153, 153 240, 240 173, 173 222, 222
 Topper198, 198202, 202220, 220255, 255116, 232
 Top 76-6-BC1F6 120, 120 153, 153 240, 240 173, 173 222 , 232

Fresh root weights of parental sorghum genotypes and their BC1F6 progeny_

Trial 1Trial 2
GenotypeRoot weight (g)aRoot weight (g)a
Top 76-663.3Ab 97.8Ab
Top 76-6-BC1F656.6AB69.2B
Honey Drip43.9BC52.6BCD
Dale-BC1F641.4BCD53.7BC
Entry 22-BC1F641.1CD43.3CDE
Collier40.9CD32.9DE
Collier-BC1F640.1CD31.5E
GT-IR738.5CD27.9E
GT-IR7-BC1F638.3CD30.6E
Dale37.1CD39.5CDE
Entry 2226.6D24.0E

Total M_ incognita eggs and eggs/gram of root of parental sorghum genotypes and their BC1F6 progeny that have the M_ incognita resistance QTL QTL-Sb_RKN_3_1_

GenotypeTotal eggsa Eggs/g roota
Dale425775Ab 11141Ab
Top 76-6297250A3977A
Collier206325A5856A
GT-IR7170125A5584A
Entry 22115808A4661A
Honey Drip2300B48B
Collier-BC1F61175B36B
Entry 22-BC1F6975B20B
Dale-BC1F6875B19B
Top 76-6-BC1F6750B18B
GT-IR7-BC1F6625B16B

Genotyping information for the creation of sorghum BC1F6 lines_

Date of PCRSorghum seedling(s) with confirmed crossMicrosatelite markers used
7/17/2015Honey Drip x CollierTRKN1, TRKN3, TRKN4
8/4/2015Honey Drip x GT-IR7TRKN1, TRKN3, TRKN4, TRKN5
8/4/2015Honey Drip x Entry 22TRKN1, TRKN3, TRKN4, TRKN5
8/4/2015Honey Drip x Entry 22TRKN1, TRKN3, TRKN4, TRKN5
8/25/2015Honey Drip x DaleTRKN1, TRKN3, TRKN4, TRKN5
11/30/2015Honey Drip x Top 76-6RKNP402, RKNP342
11/30/2015Entry 22 x (Honey Drip x Entry 22)RKNP402, RKNP342
12/16/2015Honey Drip x Top 76-6RKNP194, RKNP259, RKNP402, RKNP529
1/26/2016Dale x (Honey Drip x Dale)RKNP194, RKNP259, RKNP465, RKNP529
2/19/2016GT-IR7 x (Honey Drip x GT-IR7)TRKN4, TRKN3, RKNP529, RKNP638
2/29/2016Collier x (Honey Drip x Collier)RKNP529, RKNP638
3/9/2016GT-IR7 x (Honey Drip x GT-IR7)RKNP529, TRKN3, RKNP638
3/14/2016GT-IR7 x (Honey Drip x GT-IR7)RKNP638, RKNP194, RKNP465
3/15/2016GT-IR7 x (Honey Drip x GT-IR7)RKNP638, RKNP194, RKNP465
3/28/2016Entry 22 x (Honey Drip x Entry 22) F2 homozygousRKNP342, RKNP402, RKNP529
3/28/2016Collier x (Honey Drip x Collier)RKNP342, RKNP402, RKNP529
4/20/2016Top 76-6 x (Honey Drip x Top 76-6)RKNP342, RKNP402, RKNP529
4/20/2016Entry 22 x (Honey Drip x Entry 22) F2 homozygousRKNP342, RKNP402, RKNP529
4/21/2016Entry 22 x (Honey Drip x Entry 22) F2 homozygousRKNP342, RKNP402, RKNP529
5/6/2016Dale x (Honey Drip x Dale) F2 homozygousRKNP342, RKNP402, RKNP529
5/11/2016Dale x (Honey Drip x Dale) F2 homozygousRKNP342, RKNP402, RKNP529
6/1/2016Dale x (Honey Drip x Dale) F2 homozygousRKNP342, RKNP402, RKNP529
6/8/2016Dale x (Honey Drip x Dale) F2 homozygousRKNP342, RKNP402, RKNP529
6/9/2016GT-IR7 x (Honey Drip x GT-IR7) F2 homozygousRKNP342, RKNP402, RKNP529
6/22/2016Collier x (Honey Drip x Collier) F2 homozygousRKNP342, RKNP402, RKNP529
8/30/2016Top76-6 x (Honey Drip x Top 76-6) F2 homozygousRKNP529, RKNP638, RKNP709, RKNP821
6/15/2017Genotyping of BC1F6 lines to determine the size of the Honey Drip crossover in the RKN regionRKNP17, RKNP135, RKNP342, RKNP402, RKNP529

Recurrent sorghum parents used for marker-assisted selection of the M_ incognita resistance QTL, QTL-Sb_RKN_3_1, from ‘Honey Drip’ (PI 641821)_

NamePI numberReference/sourceSorghum type
CollierPI 641862 Maunder (2000) sweet
DalePI 651495 Broadhead and Coleman (1973) sweet
Entry 22–University of Floridaforage
GT-IR7PI 602445 Widstrom (1998) grain
Top 76-6PI 583832 Day et al. (1995) sweet

Sorghum primer sequences of microsatellite markers used for confirming sorghum crosses in the M_ incognita resistance quantitative trait locus region_

MarkerForward sequenceReverse sequenceRepeat motifExpected amplicon (bp)a
RKNP17GCAGTTTTTCAAGGAACGTGGAGGAATGGGTGATGAAACAA(TTA)106422
RKNP135GTTTCGTTTCAATCGGCTTCGCGCCCCATCATATGTCTT(AAG)21197
RKNP194TCATACTACCACAGCCGCTAGATGGTGTAGATGTGTGTGATTCAA(AT)40236
RKNP259AGCTCTTCAGGCACATCGTTTCTCCTTCCCACCCTGTATG(GA)48243
RKNP342TTCCAACAGGCAAACAACAGTCATGGCCTGTGTATCAAGC(CT)25205
RKNP402TCAGCAAGATGGTTGGTTGAACGAGGCCGTTGAGATTATG(TTA)22213
RKNP465TGACTGAGAGGGTCTACCTAACGCAACCGGAAGTACGCTGATT(AT)19247
RKNP529GCGAAATGGAGAAGAACAGGCGTCATCAGCTTCCAGGAGT(GA)25199
RKNP638CCACACCGGTTTCCTGTTATTAATAAGCCCCGCATGAAGA(ATA)21, (TAT)6, (TAA)25251
RKNP709GCAAGCTGAAGTGGCCTAGTCTACTCCCTCCGTCCCAAAT(CT)9, (TA)18324
RKNP821CTCGGCAGCACCAAATAAAATCTCAACCGATGATTGTCCA(TA)51199
TRKN1TGTACACTGCATGCCAACCTGCCTCGTCTGGTTCATTGTT(AT)14246
TRKN3GAAGAATTGCTCCAGGAACGAAGCAGTATCCGGGGAAGAT(TA)10271
TRKN4CGTAAATGGAGGTGGCTACACCCGGTTGGTACAACATAGA(AT)29232
TRKN5ACTGTTATGTCGGCTGGTCAAGTGTTACTGCCTGGCCAAA(TC)11196
DOI: https://doi.org/10.21307/jofnem-2021-087 | Journal eISSN: 2640-396X | Journal ISSN: 0022-300X
Journal RSS Feed
Language: English
Page range: 1 - 10
Published on: Nov 11, 2021
Published by: Society of Nematologists, Inc.
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year
Keywords:
Breeding,
Markers,
Nematode resistance,
QTL,
Sorghum bicolor
Related subjects:
Life sciences,
Life sciences, other

© 2021 Richard F. Davis, Karen R. Harris-Shultz, Joseph E. Knoll, Hongliang Wang, published by Society of Nematologists, Inc.
This work is licensed under the Creative Commons Attribution 4.0 License.

Previous articleVolume 53 (2021): Issue 1 (January 2021)Next article