Have a personal or library account? Click to login
Transfer of Meloidogyne incognita Resistance Using Marker-assisted Selection in Sorghum Cover

Transfer of Meloidogyne incognita Resistance Using Marker-assisted Selection in Sorghum

Journal of Nematology
Volume 53 (2021): Issue 1 (January 2021)
By: Richard F. Davis,  Karen R. Harris-Shultz,  Joseph E. Knoll and  Hongliang Wang  
Open Access
|Nov 2021

Figures & Tables

Figure 1:

Polyacrylamide gel image of microsatellite marker RKNP135 from the sorghum donor line ‘Honey Drip’, the recurrent parents ‘Collier’, GT-IR7, ‘Dale’, and ‘Top 76-6’, and the BC1F6 progeny lines. A 50-350 bp sizing standard (LI-COR Biosciences, Lincoln, NE) was loaded in the first and last lanes.
Polyacrylamide gel image of microsatellite marker RKNP135 from the sorghum donor line ‘Honey Drip’, the recurrent parents ‘Collier’, GT-IR7, ‘Dale’, and ‘Top 76-6’, and the BC1F6 progeny lines. A 50-350 bp sizing standard (LI-COR Biosciences, Lincoln, NE) was loaded in the first and last lanes.

Presence of the introgression from ‘Honey Drip’ in the QTL-Sb_RKN_3_1 region of each backcross (BC1F6) line_

Allele Sizes (bp)
RKNP17a RKNP135RKNP342RKNP402RKNP529
NC_012872 (bp)b(52,744,750)(53,190,542)(53,974,058)(54,199,591)(54,678,311)
Genotype
 Honey Drip 120, 120 153, 153 240, 240 173, 173 222, 222
 Entry 22198, 198210, 210222, 222204, 204185, 185
 Entry 22-BC1F6 120, 120 153, 153 240, 240 173, 173 222, 222
 Collier198, 198200, 200220, 220253, 253116, 116
 Collier-BC1F6 120, 120 153, 153 240, 240 173, 173 222, 222
 GT-IR7198, 245210, 210220, 220265, 265116, 232
 GT-IR7-BC1F6 120, 120 153, 153 240, 240 173, 173 222 , 232
 Dale198, 198206, 206222, 222234, 234185, 185
 Dale-BC1F6 120, 120 153, 153 240, 240 173, 173 222, 222
 Topper198, 198202, 202220, 220255, 255116, 232
 Top 76-6-BC1F6 120, 120 153, 153 240, 240 173, 173 222 , 232

Fresh root weights of parental sorghum genotypes and their BC1F6 progeny_

Trial 1Trial 2
GenotypeRoot weight (g)aRoot weight (g)a
Top 76-663.3Ab 97.8Ab
Top 76-6-BC1F656.6AB69.2B
Honey Drip43.9BC52.6BCD
Dale-BC1F641.4BCD53.7BC
Entry 22-BC1F641.1CD43.3CDE
Collier40.9CD32.9DE
Collier-BC1F640.1CD31.5E
GT-IR738.5CD27.9E
GT-IR7-BC1F638.3CD30.6E
Dale37.1CD39.5CDE
Entry 2226.6D24.0E

Total M_ incognita eggs and eggs/gram of root of parental sorghum genotypes and their BC1F6 progeny that have the M_ incognita resistance QTL QTL-Sb_RKN_3_1_

GenotypeTotal eggsa Eggs/g roota
Dale425775Ab 11141Ab
Top 76-6297250A3977A
Collier206325A5856A
GT-IR7170125A5584A
Entry 22115808A4661A
Honey Drip2300B48B
Collier-BC1F61175B36B
Entry 22-BC1F6975B20B
Dale-BC1F6875B19B
Top 76-6-BC1F6750B18B
GT-IR7-BC1F6625B16B

Genotyping information for the creation of sorghum BC1F6 lines_

Date of PCRSorghum seedling(s) with confirmed crossMicrosatelite markers used
7/17/2015Honey Drip x CollierTRKN1, TRKN3, TRKN4
8/4/2015Honey Drip x GT-IR7TRKN1, TRKN3, TRKN4, TRKN5
8/4/2015Honey Drip x Entry 22TRKN1, TRKN3, TRKN4, TRKN5
8/4/2015Honey Drip x Entry 22TRKN1, TRKN3, TRKN4, TRKN5
8/25/2015Honey Drip x DaleTRKN1, TRKN3, TRKN4, TRKN5
11/30/2015Honey Drip x Top 76-6RKNP402, RKNP342
11/30/2015Entry 22 x (Honey Drip x Entry 22)RKNP402, RKNP342
12/16/2015Honey Drip x Top 76-6RKNP194, RKNP259, RKNP402, RKNP529
1/26/2016Dale x (Honey Drip x Dale)RKNP194, RKNP259, RKNP465, RKNP529
2/19/2016GT-IR7 x (Honey Drip x GT-IR7)TRKN4, TRKN3, RKNP529, RKNP638
2/29/2016Collier x (Honey Drip x Collier)RKNP529, RKNP638
3/9/2016GT-IR7 x (Honey Drip x GT-IR7)RKNP529, TRKN3, RKNP638
3/14/2016GT-IR7 x (Honey Drip x GT-IR7)RKNP638, RKNP194, RKNP465
3/15/2016GT-IR7 x (Honey Drip x GT-IR7)RKNP638, RKNP194, RKNP465
3/28/2016Entry 22 x (Honey Drip x Entry 22) F2 homozygousRKNP342, RKNP402, RKNP529
3/28/2016Collier x (Honey Drip x Collier)RKNP342, RKNP402, RKNP529
4/20/2016Top 76-6 x (Honey Drip x Top 76-6)RKNP342, RKNP402, RKNP529
4/20/2016Entry 22 x (Honey Drip x Entry 22) F2 homozygousRKNP342, RKNP402, RKNP529
4/21/2016Entry 22 x (Honey Drip x Entry 22) F2 homozygousRKNP342, RKNP402, RKNP529
5/6/2016Dale x (Honey Drip x Dale) F2 homozygousRKNP342, RKNP402, RKNP529
5/11/2016Dale x (Honey Drip x Dale) F2 homozygousRKNP342, RKNP402, RKNP529
6/1/2016Dale x (Honey Drip x Dale) F2 homozygousRKNP342, RKNP402, RKNP529
6/8/2016Dale x (Honey Drip x Dale) F2 homozygousRKNP342, RKNP402, RKNP529
6/9/2016GT-IR7 x (Honey Drip x GT-IR7) F2 homozygousRKNP342, RKNP402, RKNP529
6/22/2016Collier x (Honey Drip x Collier) F2 homozygousRKNP342, RKNP402, RKNP529
8/30/2016Top76-6 x (Honey Drip x Top 76-6) F2 homozygousRKNP529, RKNP638, RKNP709, RKNP821
6/15/2017Genotyping of BC1F6 lines to determine the size of the Honey Drip crossover in the RKN regionRKNP17, RKNP135, RKNP342, RKNP402, RKNP529

Recurrent sorghum parents used for marker-assisted selection of the M_ incognita resistance QTL, QTL-Sb_RKN_3_1, from ‘Honey Drip’ (PI 641821)_

NamePI numberReference/sourceSorghum type
CollierPI 641862 Maunder (2000) sweet
DalePI 651495 Broadhead and Coleman (1973) sweet
Entry 22–University of Floridaforage
GT-IR7PI 602445 Widstrom (1998) grain
Top 76-6PI 583832 Day et al. (1995) sweet

Sorghum primer sequences of microsatellite markers used for confirming sorghum crosses in the M_ incognita resistance quantitative trait locus region_

MarkerForward sequenceReverse sequenceRepeat motifExpected amplicon (bp)a
RKNP17GCAGTTTTTCAAGGAACGTGGAGGAATGGGTGATGAAACAA(TTA)106422
RKNP135GTTTCGTTTCAATCGGCTTCGCGCCCCATCATATGTCTT(AAG)21197
RKNP194TCATACTACCACAGCCGCTAGATGGTGTAGATGTGTGTGATTCAA(AT)40236
RKNP259AGCTCTTCAGGCACATCGTTTCTCCTTCCCACCCTGTATG(GA)48243
RKNP342TTCCAACAGGCAAACAACAGTCATGGCCTGTGTATCAAGC(CT)25205
RKNP402TCAGCAAGATGGTTGGTTGAACGAGGCCGTTGAGATTATG(TTA)22213
RKNP465TGACTGAGAGGGTCTACCTAACGCAACCGGAAGTACGCTGATT(AT)19247
RKNP529GCGAAATGGAGAAGAACAGGCGTCATCAGCTTCCAGGAGT(GA)25199
RKNP638CCACACCGGTTTCCTGTTATTAATAAGCCCCGCATGAAGA(ATA)21, (TAT)6, (TAA)25251
RKNP709GCAAGCTGAAGTGGCCTAGTCTACTCCCTCCGTCCCAAAT(CT)9, (TA)18324
RKNP821CTCGGCAGCACCAAATAAAATCTCAACCGATGATTGTCCA(TA)51199
TRKN1TGTACACTGCATGCCAACCTGCCTCGTCTGGTTCATTGTT(AT)14246
TRKN3GAAGAATTGCTCCAGGAACGAAGCAGTATCCGGGGAAGAT(TA)10271
TRKN4CGTAAATGGAGGTGGCTACACCCGGTTGGTACAACATAGA(AT)29232
TRKN5ACTGTTATGTCGGCTGGTCAAGTGTTACTGCCTGGCCAAA(TC)11196
DOI: https://doi.org/10.21307/jofnem-2021-087 | Journal eISSN: 2640-396X | Journal ISSN: 0022-300X
Journal RSS Feed
Language: English
Page range: 1 - 10
Published on: Nov 11, 2021
Published by: Society of Nematologists, Inc.
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year
Keywords:
Breeding,
Markers,
Nematode resistance,
QTL,
Sorghum bicolor
Related subjects:
Life sciences,
Life sciences, other

© 2021 Richard F. Davis, Karen R. Harris-Shultz, Joseph E. Knoll, Hongliang Wang, published by Society of Nematologists, Inc.
This work is licensed under the Creative Commons Attribution 4.0 License.

Previous articleVolume 53 (2021): Issue 1 (January 2021)Next article