Figure S1:
Modified Baermann funnel apparatus diagram. The modified Baermann funnel apparatus uses a 100 mL beaker instead of the traditional funnel. Mesh is placed into the mouth of the beaker and up to 4 layers of Kimwipes are placed on the mesh. Nematode eggs (or soil) are placed onto the paper and immersed in water. After three days, the paper and mesh are removed and the nematodes sitting at the bottom of the beaker are collected. The modified apparatus allows for J2 collection from small volumes of soil or isolated eggs.
Table 1.
Primers for qRT-PCR.
| Name | 5′-3′ |
|---|---|
| McITS2 forward | GGGGTCAAACCCTTTGGCACGTCTGG |
| McITS2 reverse | GCGGGTGATCTCGACTGAGTTCAGG |
| Mc00773 forward | AAGTTGCCGATAGCATTGCG |
| Mc00773 reverse | TCCGGAAGAGCATGACGAAT |
| Mc03439 forward | TGCAGTTGCTGAGAGTTGTC |
| Mc03439 reverse | TGCATGGTGGAATAACCAAAGT |
| Mc03992 forward | TGATCGTTCGACTTCTGGACA |
| Mc03992 reverse | GCACGAGTGCCTTGAACTTG |
| Mc04677 forward | CTGCACATCAGAAGAAAAATGCT |
| Mc04677 reverse | TCCACAGGGTCACAACTTCC |
| Mc04921 forward | TCGTGTTAGCGGTGATGGTT |
| Mc04921 reverse | CGTTTCGGTGCCAAGTTCAG |
| Mc08895 forward | TCTTTGCACGAAGTTGATCG |
| Mc08895 reverse | TTTAATCCATTTACAAAAAGCCCT |
| Mc10400 forward | CAAGGAGGTGGAAAAACGCC |
| Mc10400 reverse | GGGTTCTTGATTCCCAACCG |
| Mc01565 forward | CAGCTGAATCTTCTGCCCCA |
| Mc01565 reverse | AATAGCAACGGCTGGAGCTT |
| Mc06869 forward | CCACATCATCATCATCATTCAAGT |
| Mc06869 reverse | CCCATGGCCAAGTTGAACC |
| Mc08299 forward | GAATTACGCCGCTTTCTTGGT |
| Mc08299 reverse | TGCACATTCAGGCCACTCAT |
| Mc07118 forward | TGGTTGTTATGAACATTCTGGCG |
| Mc07118 reverse | CCAGGTTTGTTAGGTAAGGCAG |
| Mc10102 forward | TCCACATCATCCTGGAGGTC |
| Mc10102 reverse | ATGAAAAGCACCAGCCCCAT |
Figure 1:
Acid fuchsin staining of Meloidogyne chitwoodi in potato roots at 4 (A), 8 (B) and 16 (C) days post inoculation (dpi). Bars, 50 µm.
Table 2.
Meloidogyne chitwoodi RNA-seq libraries and mapping to genome.
| Library | Bio-replicate | Read pairs | Read pairs mapped to genome | Mapping rate (%) |
|---|---|---|---|---|
| Pre-parasitic J2 | A | 51 950 815 | 25 570 659 | 49.60% |
| Pre-parasitic J2 | B | 43 883 143 | 21 477 892 | 49.00% |
| Pre-parasitic J2 | C | 44 867 529 | 22 072 545 | 49.20% |
| Mc1-potato 8 dpi | A | 46 115 017 | 1 572 404 | 3.40% |
| Mc1-potato 8 dpi | B | 40 726 172 | 1 294 772 | 3.20% |
| Mc1-potato 8 dpi | C | 40 068 646 | 1 357 759 | 3.40% |
Figure 2:
Gene Ontology (GO) term level 2 categories of genes for up (A) and down (B) regulated genes from M. chitwoodi parasitic stage compared to pre-parasitic J2. Bars show the number of sequences with annotations under each term. BP = biological processes, MP = molecular processes, CC = cellular function.
Table 3.
Top 10 most differentially expressed genes in parasitic M. chitwoodi juveniles.
| Log FC | Description | ||
| Up-regulated | 1 | 12.2878 | Putative cuticular collagen |
| 2 | 10.8863 | ---NA--- | |
| 3 | 10.6047 | Putative esophageal gland cell secretory protein 14 | |
| 4 | 10.5679 | ---NA--- | |
| 5 | 10.5294 | Hydroxyacyl-coenzyme A dehydrogenase, mitochondrial | |
| 6 | 9.2692 | ---NA--- | |
| 7 | 9.21531 | ---NA--- | |
| 8 | 9.21423 | Nematode cuticle collagen domain protein | |
| 9 | 9.1679 | Saposin-like type B, 1 domain and Saposin B domain and Saposin-like domain-containing protein | |
| 10 | 9.0144 | ---NA--- | |
| Down-regulated | 1 | -11.012 | C-type lectin domain-containing protein |
| 2 | -10.711 | Mucin-like protein-1 | |
| 3 | -10.681 | SCP domain-containing protein | |
| 4 | -10.443 | ---NA--- | |
| 5 | -10.308 | Beta-1,4-endoglucanase | |
| 6 | -10.234 | C-type lectin domain-containing protein | |
| 7 | -10.205 | Mucin-like protein-1 | |
| 8 | -9.9796 | ---NA--- | |
| 9 | -9.975 | ---NA--- | |
| 10 | -9.8201 | Hypothetical protein Mgra_00005110, partial |
Figure 3:
Flowchart summary of RNA-seq analysis and prediction of Meloidogyne chitwoodi genes involved in parasitism. Bioinformatic and other tools are boxed. FC, fold change. FPKM, fragments per kilobase of transcript per million mapped reads.
Table 4.
Information about the 11 M. chitwoodi genes analyzed by qRT-PCR at different life stages.
| Gene ID (aa) | BLASTx nr | BLASTx % query cover | BLASTx e-value | Predicted domains | FPKM J2 | FPKM 8 dpi |
|---|---|---|---|---|---|---|
| Mc07118 (171) | Meloidogyne graminicola MSP18 mRNA, complete cds, Genbank: MK628546.1 | 84 | 7.00E-40 | N/A | 2 | 73.9 |
| Mc10102 (103) | Unnamed protein product [Meloidogyne enterolobii] Genbank: CAD2180454.1 | 79 | 4.00E-46 | Cytochrome b5, heme binding domain | 16.7 | 418.6 |
| Mc08299 (207) | Cathepsin B [Meloidogyne graminicola]Genbank KAF7630769.1 | 89 | 7.00E-45 | cysteine proteinase | 26.4 | 476 |
| Mc04921 (544) | hypothetical protein Mgra_00005223 [Meloidogyne graminicola] Genbank KAF7635403.1 | 34 | 6.00E-74 | Thioredoxin-like fold | 2.9 | 50.4 |
| Mc06869 (63) | N/A | N/A | 39.2 | 1704.9 | ||
| Mc03992 (306) | Hypothetical protein Mgra_00005223 [Meloidogyne graminicola] Genbank KAF76334147.1 | 49 | 3.20E-02 | N/A | 4.3 | 69.8 |
| Mc01565 (430) | Unnamed protein product [Meloidogyne enterolobii] Genbank: CAD2124200.1 | 18 | 2.00E-22 | N/A | 7.3 | 288.1 |
| Mc08895 (332) | Unnamed protein product [Meloidogyne enterolobii] Genbank: CAD2174631.1 | 32 | 5.00E-25 | N/A | 3.5 | 123.7 |
| Mc04677 (315) | Hypothetical protein Mgra_00005223 [Meloidogyne graminicola] Genbank KAF7635986.1 | 59 | 7.00E-54 | N/A | 2.3 | 51.8 |
| Mc03439 (79) | Hypothetical protein Mgra_00005223 [Meloidogyne graminicola] Genbank KAF7630992.1 | 97 | 1.00E-23 | N/A | 25.8 | 1319.5 |
| Mc10400 (130) | N/A | N/A | 7.2 | 154.8 |
Figure 4:
The expression level of selected M. chitwoodi genes in J2 and in parasitic nematodes in potato roots at 4, 8, and 16 dpi. McITS2 was used as the reference gene. The results show the fold change relative the juvenile stage, n = 3 ± SEM, * P < 0.05 using two-tailed Student’s t test.