
Figure 1:
Photomicrographs of second-stage juveniles (J2) and cysts of Cactodera milleri from Mosca, Alamosa county, Colorado, USA. A, B: J2 anterior ends; C, D: J2 tails; E: J2 lateral field; F: Cyst posterior (ventral view); G: Cyst cone mount.
Table 1.
Primers used for molecular analysis of Cactodera spp.
| Primer | Sequence (5′→3′) | Marker | References |
|---|---|---|---|
| D2A | ACAAGTACCGTGAGGGAAAGTTG | 28S rDNA | De Ley et al. (2005) |
| D3B | TCGGAAGGAACCAGCTACTA | ||
| TW81 | GTTTCCGTAGGTGAACCTGC | ITS rDNA | Joyce et al. (1994) |
| AB28 | ATATGCTTAAGTTCAGCGGGT | ||
| JB3 | TTTTTTGGGCATCCTGAGGTTTAT | COI mtDNA | Bowles et al. (1992) |
| JB4.5 | TAAAGAAAGAACATAATGAAAATG | ||
| U288 | GAYACVGGVATYGGNATGACYAA | Hsp90 | Skantar and Carta (2004) |
| L1110 | TCRCARTTVTCCATGATRAAVAC |

Figure 2:
Phylogenetic relationships of Cactodera milleri from CO and MN with other select cyst nematodes, as inferred from a 995 bp alignment of ITS 1 and 2 rDNA, according to the GTR + I + G model of nucleotide substitution and incorporated into MB as described. A 50% majority rule consensus tree was generated with posterior probabilities (PP) shown on appropriate branches (expressed as percent), with Punctodera chalcoensis as the outgroup. New sequences are indicated in bold. Cactodera chenipodiae marked with an asterisk (*) reflect corrected identifications as described in Escobar-Avilia et al. (2020).

Figure 3:
Phylogenetic relationships of Cactodera milleri from CO and MN with other select cyst nematodes, as inferred from a 659 bp alignment of 28S rDNA, according to the GTR + I + G model of nucleotide substitution and incorporated into MB as described. A 50% majority rule consensus tree was generated with posterior probabilities (PP) shown on appropriate branches (expressed as percent), with Betulodera betulae as the outgroup. New sequences are indicated in bold.

Figure 4:
Phylogenetic relationships of Cactodera milleri from CO and MN with other Heteroderidae, as inferred from a 2340 bp alignment of Hsp90 genomic DNA, according to the GTR + I + G model of nucleotide substitution and incorporated into MB as described. A 50% majority rule consensus tree was generated with posterior probabilities (PP) shown on appropriate branches (expressed as percent), with Helicotylenchus digonicus as the outgroup. New sequences are indicated in bold.

Figure 5:
Phylogenetic relationships of Cactodera milleri from CO with other select Cactodera species nematodes, as inferred from a 358 bp alignment of mitochondrial COI, according to the GTR + I + G model of nucleotide substitution and incorporated into MB as described. A 50% majority rule consensus tree was generated with posterior probabilities (PP) shown on appropriate branches (expressed as percent), with Rhizonemella sp. and Cryphodera sinensis as the outgroups. New sequences are indicated in bold.