Figure 1:
Figure 2:
Figure 3:
Primers used in the present study_
| Primer name | Nematode | 5′-3′ Sequence | Band size | References |
|---|---|---|---|---|
| ITS5 | Forward | GGAAGTAAAAGTCGTAACAAGG | – | White et al. (1990) |
| PITSp4 | Globodera pallida | ACAACAGCAATCGTCGAG | 265 bp | Bulman and Marshall (1997); Skantar et al. (2007) |
| PITSr3 | Globodera rostochiensis | AGCGCAGACATGCCGCAA | 434 bp |
Morphological and morphometric characteristics of Moroccan population of cysts and second-stage juveniles compared to the standard Globodera pallida (EPPO, 2004)_
| Species | Shape of knob | J2 stylet length (µm) | Number of cuticula ridges | Granek’s ratio |
|---|---|---|---|---|
| G. rostochiensisa | Rounded | (21.8) | 16-31 (>14) | 1.3-9.5 (>3) |
| G. pallida a | Pointed | 22-24 (23.8) | 8-20 (<14) | 1.2-3.5 (<3) |
| Moroccan population G. pallida | Pointed | 22.6 | 9 | 2.2 |